Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU034351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd34

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGTAGCTCTCTGCCTGATGAGTCTGCTGCATCTAAATAACTTGACTTCTGCTACCACGGAGACTTCTACACAAGGAATATCCCCATCAGTTCCTACCAATGAGTCTGTTGAGGAAAATATCACATCTAGCATCCCTGGAAGTACCAGCCACTACTTGATCTATCAGGACAGCAGTAAGACCACACCAGCCATCTCAGAGACTATGGTCAACTTTACAGTTACCTCTGGGATCCCTTCAGGCTCTGGAACTCCACACACTTTTTCACAACCACAGACTTCCCCAACTGGCATACTGCCTACTACTTCAGACAGTATTTCCACTTCAGAGATGACCTGGAAGTCCAGCCTGCCATCTATAAATGTTTCTGATTATTCGCCTAATAATAGCAGCTTTGAGATGACATCACCCACCGAGCCATATGCTTACACATCATCTTCTGCTCCGAGTGCCATTAAGGGAGAAATCAAATGCTCTGGAATCCG

N° accesso Ensembl | topo

ENSMUSG00000016494

N° accesso NCBI

NM_133654

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... CD34(12490) , Cd34(12490)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Tunay Kökten et al.
PloS one, 9(1), e86011-e86011 (2014-01-28)
The sensory innervation of the dental mesenchyme is essential for tooth function and protection. Sensory innervation of the dental pulp is mediated by axons originating from the trigeminal ganglia and is strictly regulated in time. Teeth can develop from cultured
Rifat Jan et al.
Breast cancer research : BCR, 14(6), R146-R146 (2012-11-16)
Despite the benefits of endocrine therapies such as tamoxifen and aromatase inhibitors in treating estrogen receptor (ER) alpha-positive breast cancer, many tumors eventually become resistant. The molecular mechanisms governing resistance remain largely unknown. Pigment epithelium-derived factor (PEDF) is a multifunctional
Jun-Feng Liu et al.
Experimental and therapeutic medicine, 8(3), 805-812 (2014-08-15)
The number and function of endothelial progenitor cells (EPCs) may be a predictive factor for the severity and outcome of cardiovascular disease. However, the manipulation of bone marrow mononuclear cell (BMMC) cultures for EPCs is an elaborate and difficult procedure
Luisa Boldrin et al.
PLoS currents, 3, RRN1294-RRN1294 (2012-02-16)
Satellite cells, normally quiescent underneath the myofibre basal lamina, are skeletal muscle stem cells responsible for postnatal muscle growth, repair and regeneration. Since their scarcity and small size have limited study on transverse muscle sections, techniques to isolate individual myofibres
Princess I Imoukhuede et al.
PloS one, 7(9), e44791-e44791 (2012-09-18)
VEGFR surface localization plays a critical role in converting extracellular VEGF signaling towards angiogenic outcomes, and the quantitative characterization of these parameters is critical for advancing computational models; however the levels of these receptors on blood vessels is currently unknown.
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.