Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU034161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bst2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAATCTACTTCGCCGTCACAGCGAACAGCGTGGCCTGTAGAGACGGGTTGCGAGCGCAGGCTGAGTGCCGGAACACCACGCACCTGTTGCAGCGCCAGCTCACCCGCACCCAGGACAGTCTGCTGCAGGCCGAGACACAGGCAAACTCCTGCAACCTGACCGTGGTGACCCTTCAGGAGTCCCTGGAGAAGAAGGTGTCTCAAGCCCTGGAGCAGCAGGCCCGCATCAAGGAGCTTGAGAATGAAGTCACGAAGCTGAACCAGGAGCTGGAGAATCTGAGGATCCAAAAGGAGACTTCTAGCACAGTGCAGGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGTTCCTGCTCTTTTGAGGACTCATTAGTTGGCAGGTCACAGTTGTTTGAAGTCACTATGGGTCATAGTGACTCTGGAGAGGTCCTGGCAGCCCTGAGGATGTGGAAACCACTAGGG

N° accesso Ensembl | topo

ENSMUSG00000046718

N° accesso NCBI

NM_198095

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... BST2(69550) , Bst2(69550)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kerstin Gnirß et al.
Journal of virology, 89(18), 9178-9188 (2015-06-26)
The expression of the antiviral host cell factor tetherin is induced by interferon and can inhibit the release of enveloped viruses from infected cells. The Vpu protein of HIV-1 antagonizes the antiviral activity of tetherin, and tetherin antagonists with Vpu-like
Sebastian Giese et al.
PLoS pathogens, 10(7), e1004189-e1004189 (2014-07-06)
Bst-2/Tetherin inhibits the release of HIV by tethering newly formed virus particles to the plasma membrane of infected cells. Although the mechanisms of Tetherin-mediated restriction are increasingly well understood, the biological relevance of this restriction in the natural target cells
Jaraspim Narkpuk et al.
Biochemical and biophysical research communications, 450(4), 1469-1474 (2014-07-16)
While viral inhibition by tethering of budding virions to host cell membranes has been focused upon as one of the main functions of BST-2/tetherin, BST-2 is thought to possess other functions as well. Overexpression of BST-2 was found here to

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.