Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU028841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rac1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTCACACAGCGAGGACTCAAGACAGTGTTTGACGAAGCTATCCGAGCGGTTCTCTGTCCCCCTCCTGTCAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAAATGTCGGAGCCCCTCGTTCTCGGTCCTGCCTGGAACCTTTGTACGCTTTGCTCAAAAATCAGCGAGCCTTCGCATTTGATGCCAAGTTTTTGTTACAGATTAATTTTTCCATAAAACCATTTTGAACCAATGAACCAGTCAATAATTTTAAGGTTCTGTTTTAAATGTAAGAATTCCAACTTACAGTCTATTAAAATTCAGCCCTAAAATGACAAAGCCTTCTTAAAGCCTTATTTTTAAAATCCCCCATTCTTGCTCAGATTAAAAATTGCCAAAATACCTTCTGAACTAAGTTGCGTTGTGCTGAGAACACCTAAGCACTAAACTCTCTTGAGAGACTTCTGTTGCTAAGAAGACCGCAGC

N° accesso Ensembl | topo

ENSMUSG00000001847

N° accesso NCBI

NM_009007

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... RAC1(19353) , Rac1(19353)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Laurent Pieuchot et al.
Nature communications, 9(1), 3995-3995 (2018-09-30)
Cells have evolved multiple mechanisms to apprehend and adapt finely to their environment. Here we report a new cellular ability, which we term "curvotaxis" that enables the cells to respond to cell-scale curvature variations, a ubiquitous trait of cellular biotopes.
Hongxue Shi et al.
International journal of biological sciences, 11(7), 845-859 (2015-06-17)
Fibroblasts play a pivotal role in the process of cutaneous wound repair, whereas their migratory ability under diabetic conditions is markedly reduced. In this study, we investigated the effect of basic fibroblast growth factor (bFGF) on human dermal fibroblast migration
Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
S Skvortsov et al.
British journal of cancer, 110(11), 2677-2687 (2014-05-03)
In order to improve therapy for HNSCC patients, novel methods to predict and combat local and/or distant tumour relapses are urgently needed. This study has been dedicated to the hypothesis that Rac1, a Rho GTPase, is implicated in HNSCC insensitivity
Vianey Gonzalez-Villasana et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 21(9), 2127-2137 (2015-01-18)
Zoledronic acid is being increasingly recognized for its antitumor properties, but the underlying functions are not well understood. In this study, we hypothesized that zoledronic acid inhibits ovarian cancer angiogenesis preventing Rac1 activation. The biologic effects of zoledronic acid were
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.