Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU023971

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Zeb1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GATGCAGCTGACTGTGAAGGTGGCATGCCAGATGATGAACTGCCAGCAGACCAGACAGTATTACCAGGAGGCAGTGACAGGGGGGGCGGTGCCAAGAACTGCTGGCAAGACAACGTGAAAGACAACGAGTGTGACTCAGATGCAGAAAATGAGCAAAACCATGATCCGAATGTGGAAGAATTTCTGCAGCAACAAGACACCGCCGTCATTTATCCTGAGGCGCCCGAGGAAGACCAGCGGCAGGGCACACCAGAAGCCAGCAGTCATGATGAAAACGGAACACCAGATGCATTTTCCCAGTTGCTCACCTGCCCGTATTGTGATAGAGGCTACAAGCGCTTTACCTCTTTGAAAGAACACATTAAGTACCGCCATGAGAAGAACGAGGACAACTTCAGCTGCTCCCTGTGCAGTTACACCTTTGCATACAGAACCCAGCTTGAACGTCAT

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Minfei Jin et al.
PloS one, 9(8), e103965-e103965 (2014-08-05)
MicroRNA (miR)-150 has been reported to be dramatically downregulated in human epithelial ovarian cancer (EOC) tissues and patients' serum compared to normal controls. This study aimed to investigate clinical significance and molecular mechanisms of miR-150 in EOC. In the current
Jaehyuk Choi et al.
Nature genetics, 47(9), 1011-1019 (2015-07-21)
Cutaneous T cell lymphoma (CTCL) is a non-Hodgkin lymphoma of skin-homing T lymphocytes. We performed exome and whole-genome DNA sequencing and RNA sequencing on purified CTCL and matched normal cells. The results implicate mutations in 17 genes in CTCL pathogenesis
Zhenduo Lu et al.
Molecular cancer, 14, 102-102 (2015-05-15)
Restin belongs to MAGE superfamily and is known as MAGE H1. Restin was firstly cloned from HL-60 cells treated with all-trans retinoic acid (ATRA). Previous studies showed a pro-apoptotic role of Restin in several cell lines. However, little information is
Ashley M Holder et al.
Oncotarget, 6(23), 19500-19513 (2015-05-07)
Rapamycin analogues have antitumor efficacy in several tumor types, however few patients demonstrate tumor regression. Thus, there is a pressing need for markers of intrinsic response/resistance and rational combination therapies. We hypothesized that epithelial-to-mesenchymal transition (EMT) confers rapamycin resistance. We

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.