Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU021801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cxcr4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCTGCCCACCATCTACTTCATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTCATGGGTTACCAGAAGAAGCTAAGGAGCATGACGGACAAGTACCGGCTGCACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGGGCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAGGCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATCCTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACCAACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTGGGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTTGCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGACAG

N° accesso Ensembl | topo

ENSMUSG00000045382

N° accesso NCBI

NM_009911

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... CXCR4(12767) , Cxcr4(12767)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QLU
JJU
YRS
LIS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yan Wang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 21(11), 1310-1317 (2014-08-31)
C-X-C chemokine receptor type 4 (CXCR4) signaling has been demonstrated to be involved in cancer invasion and migration; therefore, CXCR4 antagonist can serve as an anti-cancer drug by preventing tumor metastasis. This study aimed to identify the CXCR4 antagonists that
Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
Jordy J Hsiao et al.
BMC cancer, 15, 204-204 (2015-04-18)
Identifying cellular signaling pathways that become corrupted in the presence of androgens that increase the metastatic potential of organ-confined tumor cells is critical to devising strategies capable of attenuating the metastatic progression of hormone-naïve, organ-confined tumors. In localized prostate cancers
Dong-Hua Luo et al.
Journal of translational medicine, 11, 203-203 (2013-08-31)
Recent studies have indicated that the expression of endothelin A receptor (ETAR) and chemokine receptor 4 (CXCR4) could be used as an indicator of the metastatic potential of nasopharyngeal carcinoma (NPC). The aim of this study was to determine the
Meng-Feng Tsai et al.
Scientific reports, 5, 13574-13574 (2015-09-05)
Malignant pleural effusion (MPE) is a common clinical problem in non-small cell lung carcinoma (NSCLC) patients; however, the underlying mechanisms are still largely unknown. Recent studies indicate that the frequency of the L858R mutant form of the epidermal growth factor
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.