Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU015681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cyba

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGACGTTTCACACAGTGGTATTTCGGCGCCTACTCTATCGCTGCAGGTGTGCTCATCTGTCTGCTGGAGTATCCCCGGGGAAAGAGGAAAAAGGGGTCCACCATGGAGCGATGTGGACAGAAGTACCTGACCCCTGTGGTGAAGCTTTTCGGGCCCCTCACCAGGAATTACTACGTCCGGGCTGCCCTCCACTTCCTGTTGTCGGTGCCTGCAGGCTTCCTCCTGGCCACCATCCTGGGGACCGTCTGCTTGGCCATTGCCAGTGTGATCTATCTGCTGGCAGCCATCCGAGGTGAGCAGTGGACTCCCATTGAGCCTAAACCCAAGGAGCGGCCACAGGTTGGAGGCACCATCAAGCAACCACCTACCAACCCCCCACCCCGGCCACCCGCAGAGGTCCGAAAGAAGCCGAGTGAGGGTGAAGAGGAG

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Rui Yamaguchi et al.
Blood cells, molecules & diseases, 57, 85-90 (2016-02-09)
Granulocyte-macrophage colony stimulating factor (GM-CSF) induces procoagulant activity of macrophages. Tissue factor (TF) is a membrane-bound glycoprotein and substance P (SP) is a pro-inflammatory neuropeptide involved in the formation of membrane blebs. This study investigated the role of SP in
Young-Hoon Lee et al.
FEBS letters, 588(17), 3251-3258 (2014-07-30)
The expression of phospholipase D1 (PLD1) and PLD2 were found to decrease at the transcription level during both replicative and premature senescence in human lung fibroblast IMR-90 cells. Knockdown of PLD2 dramatically induced senescent phenotype in proliferating IMR-90 cells and
Jessica M Overstreet et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(4), 1258-1268 (2014-12-07)
Effective therapy to prevent organ fibrosis, which is associated with more than half of all mortalities, remains elusive. Involvement of tumor suppressor ataxia telangiectasia mutated (ATM) in the TGF-β1 pathway related to renal fibrosis is largely unknown. ATM activation (pATM(Ser1981))
Chih-Chang Hung et al.
Oncotarget, 6(6), 4110-4125 (2015-02-18)
Cisplatin (CDDP) is a potent chemotherapeutic agent but resistance to the drug remains a major challenge in cancer treatment. To evaluate the efficacy of CDDP in oral squamous cell carcinoma (OSCC), we found that p22phox was highly expressed in CDDP-resistant

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.