Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU001801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tert

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGTGGTGAACTTCCCTGTGGAGCCTGGTACCCTGGGTGGTGCAGCTCCATACCAGCTGCCTGCTCACTGCCTGTTTCCCTGGTGTGGCTTGCTGCTGGACACTCAGACTTTGGAGGTGTTCTGTGACTACTCAGGTTATGCCCAGACCTCAATTAAGACGAGCCTCACCTTCCAGAGTGTCTTCAAAGCTGGGAAGACCATGCGGAACAAGCTCCTGTCGGTCTTGCGGTTGAAGTGTCACGGTCTATTTCTAGACTTGCAGGTGAACAGCCTCCAGACAGTCTGCATCAATATATACAAGATCTTCCTGCTTCAGGCCTACAGGTTCCATGCATGTGTGATTCAGCTTCCCTTTGACCAGCGTGTTAGGAAGAACCTCACATTCTTTCTGGGCATCATCTCC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ki Chan Kim et al.
Molecular neurobiology, 53(10), 7312-7328 (2015-12-24)
In addition to its classical role as a regulator of telomere length, recent reports suggest that telomerase reverse transcriptase (TERT) plays a role in the transcriptional regulation of gene expression such as β-catenin-responsive pathways. Silencing or over-expression of TERT in
T Liu et al.
British journal of cancer, 108(11), 2272-2280 (2013-05-18)
Telomerase and telomerase reverse transcriptase (hTERT) confer cancer cells sustained proliferation and survival potentials. Targeting telomerase or hTERT is a novel anti-cancer strategy. However, telomerase/hTERT inhibition alone has minimal clinical efficacy. We explored the relationship between hTERT and cyclooxygenase 2
Xin Tian et al.
Evidence-based complementary and alternative medicine : eCAM, 2015, 546210-546210 (2016-01-20)
Bufalin, a digoxin-like active component of the traditional Chinese medicine Chan Su, exhibits potent antitumor activities in many human cancers. Bufalin induces mitochondria-dependent apoptosis in cancer cells, but the detailed molecular mechanisms are largely unknown. hTERT, the catalytic subunit of
Lei Wang et al.
Journal of biomedical nanotechnology, 11(9), 1653-1661 (2015-10-22)
Current diagnostic techniques do not reliably detect cancer at early stages, and traditional chemotherapy lacks specificity and causes systemic toxicity. To address these issues, multifunctional nanomaterials are becoming more widely studied as a means of cancer detection, therapy, and monitoring.
Zhiping Liu et al.
PloS one, 8(1), e53576-e53576 (2013-01-18)
Our previous work had found that telomerase rejuvenated in the cytoplasm of corneal epithelial cells cultured in embryonic stem cell-conditioned medium, the functional properties of stem-like corneal epithelial cells can be enhanced by co-culturing with embryonic stem cells (ESCs) via

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.