Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU184131

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTTTGCAAAAGGGGGAAAGTAGTTTGCTGCCTCTTTAAGACTAGGACTGAGAGAAAGAAGAGGAGAGAGAAAGAAAGGGAGAGAAGTTTGAGCCCCAGGCTTAAGCCTTTCCAAAAAATAATAATAACAATCATCGGCGGCGGCAGGATCGGCCAGAGGAGGAGGGAAGCGCTTTTTTTGATCCTGATTCCAGTTTGCCTCTCTCTTTTTTTCCCCCAAATTATTCTTCGCCTGATTTTCCTCGCGGAGCCCTGCGCTCCCGACACCCCCGCCCGCCTCCCCTCCTCCTCTCCCCCCGCCCGCGGGCCCCCCAAAGTCCCGGCCGGGCCGAGGGTCGGCGGCCGCCGGCGGGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SOX2(6657) , Sox2()

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jiaxuan Chen et al.
Molecular carcinogenesis, 56(10), 2267-2278 (2017-05-26)
Fas signaling promotes colorectal cancer (CRC) metastasis by inducing epithelial-mesenchymal transition (EMT). The acquisition of EMT properties in turn induces stemness but the mechanism by which Fas signaling contributes to it still remains unclear. Hence, the aim of this study
Liang Tang et al.
Pathology oncology research : POR, 24(4), 907-913 (2018-04-06)
Osteosarcoma (OS) was a prevalent malignant bone tumor which threatens people's health worldwide. Wnt/β catenin signaling pathway had been proved significant in various cancers, indicating its possible function in OS as well. Sox2, a crucial member among SOX family could
Nicolas Chassaing et al.
Genome research, 26(4), 474-485 (2016-02-20)
Ocular developmental anomalies (ODA) such as anophthalmia/microphthalmia (AM) or anterior segment dysgenesis (ASD) have an estimated combined prevalence of 3.7 in 10,000 births. Mutations in SOX2 are the most frequent contributors to severe ODA, yet account for a minority of
Tatsuya Ishiguro et al.
Cancer research, 76(1), 150-160 (2015-12-17)
The establishment of cancer stem-like cell (CSC) culture systems may be instrumental in devising strategies to fight refractory cancers. Inhibition of the Rho kinase ROCK has been shown to favorably affect CSC spheroid cultures. In this study, we show how
Keshav Gopal et al.
Oncotarget, 7(3), 3111-3127 (2015-12-20)
We have previously identified a novel intra-tumoral dichotomy in breast cancer based on the differential responsiveness to a Sox2 reporter (SRR2), with cells responsive to SRR2 (RR) being more stem-like than unresponsive cells (RU). Here, we report that RR cells

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.