Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU158921

Sigma-Aldrich

MISSION® esiRNA

targeting human IL1RL1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAAATCGTGTGTTTGCCTCAGGCCAACTTCTGAAGTTTCTACCAGCTGCAGTTGCTGATTCTGGTATTTATACCTGTATTGTCAGAAGTCCCACATTCAATAGGACTGGATATGCGAATGTCACCATATATAAAAAACAATCAGATTGCAATGTTCCAGATTATTTGATGTATTCAACAGTATCTGGATCAGAAAAAAATTCCAAAATTTATTGTCCTACCATTGACCTCTACAACTGGACAGCACCTCTTGAGTGGTTTAAGAATTGTCAGGCTCTTCAAGGATCAAGGTACAGGGCGCACAAGTCATTTTTGGTCATTGATAATGTGATGACTGAGGACGCAGGTGATTACACC

N° accesso Ensembl | uomo

ENSG00000115602

N° accesso NCBI

NM_016232

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... IL1RL1(9173) , IL1RL1(9173)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

S Stojkovic et al.
Journal of thrombosis and haemostasis : JTH, 12(6), 948-957 (2014-04-08)
Urokinase-type plasminogen activator (u-PA) plays a pivotal role in extracellular proteolysis and is thought to be critically involved in the modulation of angiogenesis. Interleukin (IL)-33 is a member of the IL-1 cytokine family, which is thought to act as danger
Xi-Xiang Yu et al.
Digestive diseases and sciences, 60(5), 1265-1272 (2015-02-07)
As a pro-inflammatory cytokine, IL-33 has been demonstrated to play an important role in tumor progression. It is reported that IL-33 is highly expressed in the serum and tumor tissues of patients with gastric cancer. However, the function of IL-33
Anne Marie Thompson et al.
American journal of physiology. Heart and circulatory physiology, 307(4), H533-H541 (2014-06-29)
Loss of vascular smooth muscle cell (VSMC) function is a hallmark of vascular disease. VSMCs become increasingly dysregulated, apoptotic, and senescent as we age. Sirtuin 1 (SirT1) is a deactylase that regulates substrates associated with stress mitigation, metabolism, and aging.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.