Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU157781

Sigma-Aldrich

MISSION® esiRNA

targeting human FLNA

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGGCTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCCCATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGCCCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAAATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAAGGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACAGTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAGGGGATCCCATCCCTAAGAGCCCTTTC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Alessandra Mingione et al.
Journal of molecular endocrinology, 58(2), 91-103 (2016-11-23)
Parathyroid tumors display reduced sensitivity to extracellular calcium ([Ca
Qian Wang et al.
PloS one, 10(4), e0123018-e0123018 (2015-04-11)
Polycystin-2 (PC2), encoded by the PKD2 gene, is mutated in ~15% of autosomal dominant polycystic kidney disease. Filamins are actin-binding proteins implicated in scaffolding and membrane stabilization. Here we studied the effects of filamin on PC2 stability using filamin-deficient human
Anshika Sharma et al.
Frontiers in microbiology, 11, 581867-581867 (2020-10-27)
Influenza A virus (IAV) poses a major threat to global public health and is known to employ various strategies to usurp the host machinery for survival. Due to its fast-evolving nature, IAVs tend to escape the effect of available drugs
E Peverelli et al.
Endocrinology, 155(8), 2932-2941 (2014-05-16)
Somatostatin receptor type 2 (SST2) is the main pharmacological target of medical therapy for GH-secreting pituitary tumors, but molecular mechanisms regulating its expression and signaling are largely unknown. The aim of this study was to investigate the role of cytoskeleton
Donatella Treppiedi et al.
Molecular and cellular endocrinology, 524, 111159-111159 (2021-01-12)
Somatostatin receptor type 5 (SST5) represents the main pharmacological target in the treatment of adrenocorticotroph hormone (ACTH)-secreting tumors. However, molecular predictors of responsiveness to pasireotide require further investigation. The cytoskeleton protein filamin A (FLNA) modulates the responsiveness to somatostatin analogs

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.