Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU156721

Sigma-Aldrich

MISSION® esiRNA

targeting human ECM1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCTTTGAGGGACAGAGTCAAGTGCAGCCCCCTCCCTCTCAGGAGGCCACCCCTCTCCAACAGGAAAAGCTGCTACCTGCCCAACTCCCTGCTGAAAAGGAAGTGGGTCCCCCTCTCCCTCAGGAAGCTGTCCCCCTCCAAAAAGAGCTGCCCTCTCTCCAGCACCCCAATGAACAGAAGGAAGGAACGCCAGCTCCATTTGGGGACCAGAGCCATCCAGAACCTGAGTCCTGGAATGCAGCCCAGCACTGCCAACAGGACCGGTCCCAAGGGGGCTGGGGCCACCGGCTGGATGGCTTCCCCCCTGGGCGGCCTTCTCCAGACAATCTGAACCAAATCTGCCTTCCTAACCGTCAGCATGTGGTATATGGTCCCTGGAACCTACCACAGTCCAGCTACTCCCACCTCACTCGCCAGGGTGAGACCCTCAATTTCCTGGAGATTGGATATTCCCGCTGCTGCCACTGCCGCAGCCACACAAACCGCCTAGAGT

N° accesso Ensembl | uomo

ENSG00000143369

N° accesso NCBI

NM_022664

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ECM1(1893) , ECM1(1893)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
BBV
RTR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Lin-Qing Liu et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 133, 110779-110779 (2019-09-01)
MicroRNAs were known to play very important roles in human diseases, and have attracted great interests of research scientists in medicine, toxicology and functional foods. Gastric carcinoma (GC) remains one of the most common and lethal types of malignancy worldwide.
Cuixian Li et al.
PloS one, 6(10), e27053-e27053 (2011-11-03)
Malignant gliomas represent one of the most aggressive types of cancers and their recurrence is closely linked to acquired therapeutic resistance. A combination of chemotherapy is considered a promising therapeutic model in overcoming therapeutic resistance and enhancing treatment efficacy. Herein
Sophie Sarah Steinhaeuser et al.
Laboratory investigation; a journal of technical methods and pathology, 100(7), 928-944 (2020-03-24)
The tumor microenvironment is increasingly recognized as key player in cancer progression. Investigating heterotypic interactions between cancer cells and their microenvironment is important for understanding how specific cell types support cancer. Forming the vasculature, endothelial cells (ECs) are a prominent
Jie Chen et al.
Oncogene, 38(14), 2533-2550 (2018-12-12)
Many reports have described DGKα as an oncogene, hence, we investigated its function and the underlying mechanisms in esophageal squamous cell carcinoma (ESCC) progression. This study demonstrated that DGKα was upregulated by inflammatory stimulants and formed feedforward loop with Akt/NF-κB
Ariel E Cariaga-Martínez et al.
Biology open, 3(10), 924-936 (2014-09-14)
The acquisition of invasiveness is characteristic of tumor progression. Numerous genetic changes are associated with metastasis, but the mechanism by which a cell becomes invasive remains unclear. Expression of p85β, a regulatory subunit of phosphoinositide-3-kinase, markedly increases in advanced carcinoma

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.