Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU153641

Sigma-Aldrich

MISSION® esiRNA

targeting human HRH4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGAATGGGCCAATGATTCTAGTTTCAGAGTCTTGGAAGGATGAAGGTAGTGAATGTGAACCTGGATTTTTTTCGGAATGGTACATCCTTGCCATCACATCATTCTTGGAATTCGTGATCCCAGTCATCTTAGTCGCTTATTTCAACATGAATATTTATTGGAGCCTGTGGAAGCGTGATCATCTCAGTAGGTGCCAAAGCCATCCTGGACTGACTGCTGTCTCTTCCAACATCTGTGGACACTCATTCAGAGGTAGACTATCTTCAAGGAGATCTCTTTCTGCATCGACAGAAGTTCCTGCATCCTTTCATTCAGAGAGACAGAGGAGAAAGAGTAGTCTCATGTTTTCCTCAAGAACCAAGATGAATAGCAATACAATTGCTTCCAAAATGGGTTCCTTCTCCCAATCAGATTCTGTAGCTCTTCACCAAAGGGAACA

N° accesso Ensembl | uomo

ENSG00000134489

N° accesso NCBI

NM_001160166

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HRH4(59340) , HRH4(59340)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 38(3), 204-212 (2018-06-05)
Mast cell (MC) activation through H4R releases various inflammatory mediators which are associated with allergic asthma. To investigate the siRNA-mediated gene silencing effect of H4R on human mast cells (HMCs) functions and the activation of stress-activated protein kinases (SAPK)/jun amino-terminal
Anne-France Petit-Bertron et al.
PloS one, 4(8), e6504-e6504 (2009-08-08)
The most recently characterized H4 histamine receptor (H4R) is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional
Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 37(2), 133-140 (2016-07-13)
The histamine H4 receptor functionally expressed on human mast cells and their signaling pathways for the production of IL-13 and RANTES have never been analyzed side by side in a directly comparable manner. Therefore, the aim of the study was
Ya-Xin Zhao et al.
American journal of physiology. Endocrinology and metabolism, 317(6), E1158-E1171 (2019-09-25)
Although many studies have shown that histamine and its signaling regulate energy homeostasis through the central nervous system, their roles in adipose tissues remain poorly understood. Here, we identified that the histamine H4 receptor (HrH4) was highly expressed in adipocytes

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.