Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU142761

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT2A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCTGACCACGTATCCCACTTGGAGAATGTGTCAGAGGATGAGATAAACCGACTGCTGGGGATGGTGGTGGATGTGGAGAATCTCTTCATGTCTGTTCACAAGGAAGAGGACACAGACACCAAGCAGGTCTATTTCTACCTCTTCAAGCTACTGCGGAAATGCATCCTGCAGATGACCCGGCCTGTGGTGGAGGGGTCCCTGGGCAGCCCTCCATTTGAGAAACCTAATATTGAGCAGGGTGTGCTGAACTTTGTGCAGTACAAGTTTAGTCACCTGGCTCCCCGGGAGCGGCAGACGATGTTCGAGCTCTCAAAGATGTTCTTGCTCTGCCTTAACTACTGGAAGCTTGAGACACCTGCCCAGTTTCGGCAGAGGTCTCAGGCTGAGGACGTGGCTACCTACAAGGTCAATTACACCAGATGGCTCTGTTACTGCCACGTGCCCCAGAGCTGTGATAGCCTCCCCCGCTACGAAACCACTCATGTCTTTGGGC

N° accesso Ensembl | uomo

ENSG00000108773

N° accesso NCBI

NM_021078

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... KAT2A(2648) , KAT2A(2648)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Liming Zhao et al.
Oncology letters, 16(3), 3955-3963 (2018-08-22)
Histone acetyltransferase GCN5 is a critical component of the TGF-β/Smad signaling pathway in breast cancer cells; however, it remains unknown whether it is involved in the development and progression of breast cancer. The present study investigated the role of GCN5
Lijun Qiao et al.
Journal of cellular and molecular medicine, 22(11), 5333-5345 (2018-08-07)
General control nondepressible 5 (GCN5), the first identified transcription-related lysine acetyltransferase (KAT), is an important catalytic component of a transcriptional regulatory SAGA (Spt-Ada-GCN5-Acetyltransferase) and ATAC (ADA2A-containing) complex. While GCN5 has been implicated in cancer development, its role in cervical cancer
Kun Liu et al.
International journal of molecular sciences, 16(9), 21897-21910 (2015-09-18)
The general control of nucleotide synthesis 5 (GCN5), which is one kind of lysine acetyltransferases, regulates a number of cellular processes, such as cell proliferation, differentiation, cell cycle and DNA damage repair. However, its biological role in human glioma development
Changhan Ouyang et al.
Autophagy, 16(10), 1753-1770 (2019-12-28)
Macroautophagy/autophagy, a fundamental process for degradation of macromolecules and organelles, occurs constitutively at a basal level and is upregulated in response to stress. Whether autophagy regulates protein acetylation and microtubule stability in vascular smooth muscle cells (VSMCs) migration, however, remains

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.