Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU138141

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGCAGAGTGCAAGAGATGCCTCAGTCAAGTCAGCCAAAAACACGCGGGTCATCCCCAAGCCCCAGAGAGTGACAGAGCCCCGATGACACGGACACCTCGGCTGCTGTCACTTCCCTGGTTCGGGCCTCCCACAGGCTTTGAATTGAAGGCGAGTGCCTCAGAATTTGCATCCATTGTTCTGTCTTTCCTGGGAAGTTATTCATCCTGGTGGCCAGCCCACCGACAAAATGGATTTGGATCTACTGGACCTGAATCCCAGAATTATTGCTGCAATTAAGAAAGCCAAACTGAAATCGGTAAAGGAGGTTTTACACTTTTCTGGACCAGACTTGAAGAGACTGACCAACCTCTCCAGCCCCGAGGTCTGGCACTTGCTGAGAACGGCCTCCTTACACTTGCGGGGAAGCAGCATCCTTACAGCACTGCAGCTG

N° accesso Ensembl | uomo

ENSG00000126215

N° accesso NCBI

NM_001100118

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... XRCC3(7517) , XRCC3(7517)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wynand P Roos et al.
Cancer letters, 424, 119-126 (2018-03-27)
Glioblastoma is the most frequent and aggressive form of high-grade malignant glioma. Due to the dismal prognosis faced by patients suffering from this disease, there is a need for identifying new targets that might improve therapy. The aim of this
Ramon Lopez Perez et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 133, 77-86 (2019-04-03)
Carbon ion radiotherapy is a promising therapeutic option for glioblastoma patients due to its high physical dose conformity and greater biological effectiveness than photons. However, the biological effects of carbon ion radiation are still incompletely understood. Here, we systematically compared
Jo-Fan Chang et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 396-406 (2014-03-29)
The nucleus is a key organelle in mammary cells, which is responsible for several cellular functions including cell proliferation, gene expression, and cell survival. In addition, the nucleus is the primary targets of doxorubicin treatment. In the current study, low-abundance
Marco Agostini et al.
Cancer biology & therapy, 16(8), 1160-1171 (2015-05-30)
Preoperative chemoradiotherapy is widely used to improve local control of disease, sphincter preservation and to improve survival in patients with locally advanced rectal cancer. Patients enrolled in the present study underwent preoperative chemoradiotherapy, followed by surgical excision. Response to chemoradiotherapy

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.