Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU133631

Sigma-Aldrich

MISSION® esiRNA

targeting human ITCH

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCTGCCACCATACAAGAGCTATGAGCAACTGAAGGAAAAGCTGTTGTTTGCCATAGAAGAAACAGAAGGATTTGGACAAGAGTAACTTCTGAGAACTTGCACCATGAATGGGCAAGAACTTATTTGCAATGTTTGTCCTTCTCTGCCTGTTGCACATCTTGTAAAATTGGACAATGGCTCTTTAGAGAGTTATCTGAGTGTAAGTAAATTAATGTTCTCATTTAGATTTATCTCCCAGTGATTTCTACTCAGCGTTTCCAGAAATCAGGTCTGCAAATGACTAGTCAGAACCTTGCTTAACATGAGATTTTAACACAACAATGAAATTTGCCTTGTCTTATTCCACTAGTTTATTCCTTTAACAACAATATTTTATGTGTGTCAAAAGTCTCACTTGGGAGTAGTGTTTTTTTCTTTTAGACATTCTGCAGACATGCAGGGAAGTCCTTTG

N° accesso Ensembl | uomo

ENSG00000078747

N° accesso NCBI

NM_031483

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ITCH(83737) , ITCH(83737)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yoichiro Otaki et al.
Journal of the American Heart Association, 5(1) (2016-01-23)
The homologous to the E6-AP carboxyl terminus (HECT)-type ubiquitin E3 ligase ITCH is an enzyme that plays a pivotal role in posttranslational modification by ubiquitin proteasomal protein degradation. Thioredoxin-interacting protein (TXNIP) is a negative regulator of the thioredoxin system and
Lufen Chang et al.
Nucleic acids research, 47(2), 824-842 (2018-12-06)
The downregulation of the DNA damage response (DDR) enables aggressive tumors to achieve uncontrolled proliferation against replication stress, but the mechanisms underlying this process in tumors are relatively complex. Here, we demonstrate a mechanism through which a distinct E3 ubiquitin
Ji-Yeon Park et al.
Biochemical and biophysical research communications, 470(2), 336-342 (2016-01-23)
This study aimed to investigate the roles of autophagy and the ubiquitin-proteasome system in the degradation of histone deacetylase 8 (HDAC8) and to clarify the mechanism by which cAMP signaling regulates this degradation. cAMP signaling was activated by treating H1299
Nicolas Baillet et al.
Viruses, 12(1) (2020-01-08)
Lassa virus (LASV) and Mopeia virus (MOPV) are two closely related, rodent-born mammarenaviruses. LASV is the causative agent of Lassa fever, a deadly hemorrhagic fever endemic in West Africa, whereas MOPV is non-pathogenic in humans. The Z matrix protein of
Jinhong Meng et al.
Scientific reports, 10(1), 1046-1046 (2020-01-25)
P53 mutations are responsible for drug-resistance of tumour cells which impacts on the efficacy of treatment. Alternative tumour suppressor pathways need to be explored to treat p53- deficient tumours. The E3 ubiquitin ligase, ITCH, negatively regulates the tumour suppressor protein

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.