Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU130891

Sigma-Aldrich

MISSION® esiRNA

targeting human TUG1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCAAGATGCCAGTTTTTGCTTCTTTGTTAGTTGTCAGCTGCTTTTATCAAATTTCAGGCCATTATCCAACAAACACTATAAAAATGTTTGAACAATTGGATTTCAAACATTTTCGTTTTGTGGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGCAAGTGAACACAAACACATTTAAGTGTATTTTGTCTGATTAGATGTTAGCCAGTTATGCTATTTCATTCAAATGTCTGAAAAAATCAATTGACTATTCCCTTTTCCTAAAGGGCAGAGACAGATAATCTCACTTCCAGAGAAATGACTTGGAGAAAAAAAAGTGTTGGTCTTTTTGCTCTTTTGTAATTAAATCCGGATGTACCTCAAAAGACTTAAGACTGTGGTGATAAGATGCTTTCCTCAGCAGAAAGGAGGGAAAAAAAACAACTGGAACTCAAAGCTTGAAATTCTGTGGCAAAACATGAGATGTCCAGGATTGGAGGTTGAA

N° accesso Ensembl | uomo

ENSG00000182457

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TUG1(55000)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

T Xu et al.
European review for medical and pharmacological sciences, 23(11), 4698-4705 (2019-06-19)
To explore the correlation between plasma level of lncRNA TUG1 with PSA level, Gleason grading and tumor node metastasis (TNM) stage of prostate cancer (PCa) patients. This study aims to evaluate the potential diagnostic and prognostic values of TUG1 in
Yanqian Wang et al.
International journal of oncology, 54(4), 1317-1326 (2019-02-06)
Melanoma is an aggressive type of skin cancer, characterized by high mortality rates worldwide. Therefore, the identification of new diagnostic markers and therapeutic targets for melanoma is imperative. Accumulating evidence has demonstrated that long non-coding RNAs (lncRNAs) play important roles
Pan Wang et al.
Journal of experimental & clinical cancer research : CR, 39(1), 7-7 (2020-01-11)
Long noncoding RNAs (lncRNAs) are involved in the progression of various cancers and affect the response to radiotherapy. This study focused on clarifying the underlying mechanism by which lncTUG1 affects the radiosensitivity of esophageal squamous cell carcinoma (ESCC). lncTUG1, miR-144-3p
Dong Lv et al.
OncoTargets and therapy, 13, 5857-5868 (2020-07-02)
Clear cell renal cell carcinoma (ccRCC) is a common urological carcinoma in adults. Long non-coding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) has been reported to be involved in the progression of diverse human cancers, including renal cell carcinoma (RCC). However
Xiaodi Liu et al.
Journal of cellular biochemistry (2019-03-06)
This study intended to investigate the potential molecular mechanism of long noncoding RNA (lncRNA) taurine upregulated gene 1 (TUG1) in the development of sepsis-associated acute kidney injury (AKI). The expression of TUG1 in the serum from patients with sepsis resulted
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.