Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU130651

Sigma-Aldrich

MISSION® esiRNA

targeting human NDUFAF1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTTGTGAGCCGTCAGTGAAACACTTAGAGCAGTTTCTGGCACATGGTAGAATTGGGCTATTTGCTGAAGCTTCTTGGTGGCCCTTGCTAGCCCAGGAAGAAACTTACATTTTGATTTTTTTGTACCATGGCTTTGGTTCACAAATTGCTGCGTGGTACTTATTTTCTCAGAAAATTCTCTAAGCCAACTTCTGCCTTGTATCCATTTTTGGGTATTCGCTTTGCAGAGTATTCCAGTAGTCTTCAGAAACCAGTGGCTTCTCCTGGCAAAGCCTCCTCACAGAGGAAGACTGAAGGGGATTTGCAAGGAGATCACCAGAAAGAAGTTGCTTTGGATATAACTTCTTCTGAGGAGAAGCCTGATGTTAGTTTCGATAAAGCAATTAGAGATGAAGCAATATACCATTTTAGGCTTTTGAAGGATGAAATTGTGGATCATTGGAGAGGACCGGAAGGCCACCCTCTGCATGAGGTCTTGCTGGAACAAGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kelly Quesnelle et al.
Nitric oxide : biology and chemistry, 104-105, 36-43 (2020-09-07)
It is well established that myoglobin supports mitochondrial respiration through the storage and transport of oxygen as well as through the scavenging of nitric oxide. However, during ischemia/reperfusion (I/R), myoglobin and mitochondria both propagate myocardial injury through the production of
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.