Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU123581

Sigma-Aldrich

MISSION® esiRNA

targeting human THPO

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCTCAGACACTGCCGACATCAGCATTGTCTCGTGTACAGCTCCCTTCCCTGCAGGGCGCCCCTGGGAGACAACTGGACAAGATTTCCTACTTTCTCCTGAAACCCAAAGCCCTGGTAAAAGGGATACACAGGACTGAAAAGGGAATCATTTTTCACTGTACATTATAAACCTTCAGAAGCTATTTTTTTAAGCTATCAGCAATACTCATCAGAGCAGCTAGCTCTTTGGTCTATTTTCTGCAGAAATTTGCAACTCACTGATTCTCTACATGCTCTTTTTCTGTGATAACTCTGCAAAGGCCTGGGCTGGCCTGGCAGTTGAACAGAGGGAGAGACTAACCTTGAGTCAGAAAACAGAGAAAGGGTAATTTCCTTTGCTTCAAATTCAAGGCCTTCCAACGCCCCCATCCCCTTTACTATCATTCTCAGTGGGACTCTGATCCC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ting Zou et al.
Cancer biomarkers : section A of Disease markers, 25(2), 133-139 (2018-11-20)
Long noncoding RNAs (LncRNAs) are involved in the occurrence and progression of human tumors including ovarian cancer (OC). Long noncoding RNA HOTTIP has been found to be involved in several human tumors development. However, the role of HOTTIP in OC
Hideo Otsuki et al.
The Prostate, 77(2), 222-233 (2016-10-04)
Leucine stimulates cancer cell proliferation through the mTOR pathway, therefore, inhibiting leucine transporters may be a novel therapeutic target for cancer. L-type amino acid transporter (LAT) 1, a Na LNCaP and DU145 and PC-3 cell lines were used as a
Bo Li et al.
Free radical research, 52(4), 390-401 (2018-02-06)
Substantial evidence indicates that the alteration of the cellular redox status is a critical factor involved in cell growth and death and results in tumourigenesis. Cancer cells have an efficient antioxidant system to counteract the increased generation of ROS. However
Bo-Wen Dai et al.
Journal of Cancer, 10(19), 4540-4551 (2019-09-19)
As a master regulator of embryonic morphogenesis, homeodomain-containing gene 10 (HOXC10) has been found to promote progression of human cancers and indicate poor survival outcome. Therefore, we concentrate on elucidating the role of HOXC10 in progression of oral squamous cell
Jie Zhang et al.
Disease markers, 2019, 8964015-8964015 (2019-11-30)
Cyclin-dependent kinase regulatory subunit 2 (CKS2) is a member of the cell cycle-dependent protein kinase subunit family, which is implicated as an oncogene in various malignancies. However, the clinical significance, oncogenic functions, and related mechanisms of CKS2 in hepatocellular carcinoma

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.