Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU122491

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTTTCTCCGGCAAGTACCAACTGCAGAGCCAGGAAAACTTTGAAGCCTTCATGAAGGCAATCGGTCTGCCGGAAGAGCTCATCCAGAAGGGGAAGGATATCAAGGGGGTGTCGGAAATCGTGCAGAATGGGAAGCACTTCAAGTTCACCATCACCGCTGGGTCCAAAGTGATCCAAAACGAATTCACGGTGGGGGAGGAATGTGAGCTGGAGACAATGACAGGGGAGAAAGTCAAGACAGTGGTTCAGTTGGAAGGTGACAATAAACTGGTGACAACTTTCAAAAACATCAAGTCTGTGACCGAACTCAACGGCGACATAATCACCAATACCATGACATTGGGTGACATT

N° accesso Ensembl | uomo

ENSG00000163586

N° accesso NCBI

NM_001443

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FABP1(2168) , FABP1(2168)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yujuan Wang et al.
PloS one, 14(4), e0214144-e0214144 (2019-04-23)
Castration is an important means of improving the beef quality via increasing fat deposition. However, little is known about the molecular mechanism underlying the fat deposition after castration. Here, the intramuscular fat (IMF) content of the steer group was shown
Yufei Chen et al.
Journal of pharmacy & pharmaceutical sciences : a publication of the Canadian Society for Pharmaceutical Sciences, Societe canadienne des sciences pharmaceutiques, 20(0), 239-251 (2017-08-16)
To investigate the effect of clofibrate on inducing liver fatty acid binding protein (FABP1) following a high-fat load in a hepatocyte cell culture model. Rat hepatoma cells (CRL-1548) were treated with a fatty acid (FA) mixture consisting of oleate:palmitate (2:1)
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.