Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU122481

Sigma-Aldrich

MISSION® esiRNA

targeting human NANOS2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGAAGGACTACTTCAACCTGAGCCAGGTGGTGTGGGCGCTGATCGCAAGTCGGGGTCAAAGGCTGGAGACCCAAGAGATTGAGGAGCCAAGTCCCGGGCCTCCGCTGGGGCAGGATCAGGGGCTGGGGGCGCCAGGGGCCAACGGGGGCCTGGGGACCCTGTGCAACTTCTGCAAGCACAACGGGGAGTCCCGCCACGTCTACTCCTCACACCAGCTGAAGACACCGGATGGCGTGGTGGTGTGTCCCATCCTGAGGCACTACGTGTGTCCCGTGTGCGGGGCCACCGGTGACCAGGCCCATACGCTCAAGTACTGCCCGCTTAACGGTGGCCAGCAGTCCCTCTACCGCC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Laura M López-Sánchez et al.
Laboratory investigation; a journal of technical methods and pathology, 101(3), 292-303 (2020-12-03)
Cancer stem cells (CSCs) are involved in the resistance of estrogen (ER)-positive breast tumors against endocrine therapy. On the other hand, nitric oxide (NO) plays a relevant role in CSC biology, although there are no studies addressing how this important
Fangqin Wang et al.
Biosensors & bioelectronics, 172, 112756-112756 (2020-11-17)
Acute kidney injury (AKI) is common in hospital patients. Delayed diagnosis and treatment of AKI due to the lack of efficient early diagnosis is an important cause of its high mortality. While fluorescence imaging seems promising to non-intrusively interrogate AKI-related
Plinio C Casarotto et al.
PeerJ, 6, e4635-e4635 (2018-04-24)
Trichotillomania (TTM) is an impulse control disorder characterized by repetitive hair pulling/trimming. Barbering behavior (BB) observed in laboratory animals is proposed as a model of TTM. The neurobiological basis of TTM is unclear, but involves striatal hyperactivity and hypoactivation of
Huan Liu et al.
Microbiology and immunology, 62(9), 594-606 (2018-07-12)
Transcriptional regulation of inducible nitric oxide synthase (iNOS) is critically involved in the pathogenesis and progression of rheumatoid arthritis (RA); however, the specific transcription factors that control this process remain largely unidentified. In the present study, it was discovered that

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.