Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU121191

Sigma-Aldrich

MISSION® esiRNA

targeting human DES

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

N° accesso Ensembl | uomo

ENSG00000175084

N° accesso NCBI

NM_001927

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... DES(1674) , DES(1674)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Ci dispiace, ma al momento non ci sono COA disponibili online per questo prodotto.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xiao-Mei Lao et al.
Oncology letters, 11(3), 2027-2034 (2016-03-22)
Inflammation and desmoplasia are frequently identified in the tumor microenvironment, and have been demonstrated to be effective modulators of malignant biological events. However, the mechanisms by which the inflammatory microenvironment and interstitial fibrosis interact with one another remain to be
Ji Hyun Kim et al.
Anatomy & cell biology, 49(1), 50-60 (2016-04-07)
Fetal development of the face involves a specific type of cornification in which keratinocytes provide a mass or plug to fill a cavity. The epithelial-mesenchymal interaction was likely to be different from that in the usual skin. We examined expression
Monica Gunetti et al.
PloS one, 7(9), e45538-e45538 (2012-10-03)
Urinary incontinence, defined as the complaint of any involuntary loss of urine, is a pathological condition, which affects 30% females and 15% males over 60, often following a progressive decrease of rhabdosphincter cells due to increasing age or secondary to
Ji Hyun Kim et al.
Anatomy & cell biology, 46(4), 272-284 (2014-01-05)
Carbonic anhydrase type IX (CA9) is known to express in the fetal joint cartilage to maintain pH against hypoxia. Using paraffin-embedded histology of 10 human fetuses at 10-16 weeks of gestation with an aid of immunohistochemistry of the intermediate filaments
Christoph Daniel et al.
PloS one, 8(12), e83846-e83846 (2014-01-01)
We recently identified Thrombospondin-2 (TSP-2) as a regulator of matrix remodelling and inflammation in experimental kidney disease by using TSP-2 null mice and successfully proved TSP-2 overexpression as a therapeutic concept in a short term glomerulonephritis model in the rat.
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.