Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU116331

Sigma-Aldrich

MISSION® esiRNA

targeting human ENO1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATATGGGAAAGATGCCACCAATGTGGGGGATGAAGGCGGGTTTGCTCCCAACATCCTGGAGAATAAAGAAGGCCTGGAGCTGCTGAAGACTGCTATTGGGAAAGCTGGCTACACTGATAAGGTGGTCATCGGCATGGACGTAGCGGCCTCCGAGTTCTTCAGGTCTGGGAAGTATGACCTGGACTTCAAGTCTCCCGATGACCCCAGCAGGTACATCTCGCCTGACCAGCTGGCTGACCTGTACAAGTCCTTCATCAAGGACTACCCAGTGGTGTCTATCGAAGATCCCTTTGACCAGGATGACTGGGGAGCTTGGCAGAAGTTCACAGCCAGTGCAGGAATCCAGGTAGTGGGGGATGATCTCACAGTGACCAACCCAAAGAGGATCGCCAAGGCCGTGAACGAGAAGTCCTGCAACTGCCT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xiaoling Qian et al.
Oncotarget, 8(29), 47691-47708 (2017-05-27)
Chemotherapy is the major choice for the cancer treatment of early and advanced stages. However, intrinsic or acquired drug resistance significantly restricts the clinical efficacy of chemotherapy. It is critical to develop novel approaches to detect and overcome drug resistance.
Hui Qiao et al.
Journal of cellular biochemistry, 120(11), 18714-18723 (2019-06-21)
Gastric cancer has become the third most common cancer around the world. In patients with gastric cancer, the 5-year survival rate is still low. However, the mechanism underlying gastric cancer remains largely unknown. As a glycolytic enzyme, enolase 1 (ENO1)
Naoki Kishimoto et al.
Retrovirology, 17(1), 31-31 (2020-09-13)
A protein exhibiting more than one biochemical function is termed a moonlighting protein. Glycolytic enzymes are typical moonlighting proteins, and these enzymes control the infection of various viruses. Previously, we reported that glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and alpha-enolase (ENO1) are
Yasmarie Santana-Rivera et al.
American journal of translational research, 12(4), 1275-1292 (2020-05-02)
Despite good responses to first-line treatment with platinum-based combination chemotherapy, most ovarian cancer patients will relapse and eventually develop a platinum-resistant disease with a poor overall prognosis. The molecular events leading to the cisplatin resistance of ovarian cancer cells are

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.