Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU114041

Sigma-Aldrich

MISSION® esiRNA

targeting human PSMD2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAGGAGAAGTGGCTAAGGAGTGGCAGGAGCTGGATGACGCAGAGAAGGTCCAGCGGGAGCCTCTGCTCACTCTGGTGAAGGAAATCGTCCCCTATAACATGGCCCACAATGCAGAGCATGAGGCTTGCGACCTGCTTATGGAAATTGAGCAGGTGGACATGCTGGAGAAGGACATTGATGAAAATGCATATGCAAAGGTCTGCCTTTATCTCACCAGTTGTGTGAATTACGTGCCTGAGCCTGAGAACTCAGCCCTACTGCGTTGTGCCCTGGGTGTGTTCCGAAAGTTTAGCCGCTTCCCTGAAGCTCTGAGATTGGCATTGATGCTCAATGACATGGAGTTGGTAGAAGACATCTTCACCTCCTGCAAGGATGTGGTAGTACAGAAACAGATGGCATTCATGCTAGGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Peter Tsvetkov et al.
Nature chemical biology, 15(7), 681-689 (2019-05-28)
The mechanisms by which cells adapt to proteotoxic stress are largely unknown, but are key to understanding how tumor cells, particularly in vivo, are largely resistant to proteasome inhibitors. Analysis of cancer cell lines, mouse xenografts and patient-derived tumor samples
Evert Njomen et al.
Cell chemical biology, 26(9), 1283-1294 (2019-07-23)
The proteolytic arm of the protein homeostasis network is maintained by both the ubiquitin-proteasome system (UPS) and autophagy. A well-balanced crosstalk between the two catabolic pathways ensures energy-efficient maintenance of cellular function. Our current understanding of the crosstalk between the
Christoph Gerhardt et al.
The Journal of cell biology, 210(1), 115-133 (2015-07-08)
Mutations in RPGRIP1L result in severe human diseases called ciliopathies. To unravel the molecular function of RPGRIP1L, we analyzed Rpgrip1l(-/-) mouse embryos, which display a ciliopathy phenotype and die, at the latest, around birth. In these embryos, cilia-mediated signaling was
Peter Tsvetkov et al.
eLife, 4 (2015-09-04)
Proteasomes are central regulators of protein homeostasis in eukaryotes. Proteasome function is vulnerable to environmental insults, cellular protein imbalance and targeted pharmaceuticals. Yet, mechanisms that cells deploy to counteract inhibition of this central regulator are little understood. To find such

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.