Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU113961

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK7

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACTGAAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAAGACTAGAGCAGCGAACTGCGACGATCACTTAGAGAAACAGGCCGTTAGGAATCCATTCTCACTGTGTTCGCTCTAAACAAAACAGTGGTAGGTTAATGTGTTCAGAAGTCGCTGTCCTT

N° accesso Ensembl | uomo

ENSG00000116288

N° accesso NCBI

NM_007262

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PARK7(11315) , PARK7(11315)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Bijun Qiu et al.
Oncotarget, 8(5), 8499-8511 (2016-12-31)
Chronic liver inflammation and injuries play a critical role in development of hepatocellular carcinoma (HCC). Parkinson disease (autosomal recessive, early onset) 7, encoding PARK7 protein (also called DJ-1), plays important roles in many carcinogenesis processes and is essential in modulating
Hua-Zong Zeng et al.
International journal of molecular sciences, 12(6), 3489-3499 (2011-07-13)
The aim of study is to identify cisplatin-resistance associated biomarkers for non-small cell lung cancers (NSCLC). We use two-dimensional electrophoresis (2-DE) combined with MALDI-TOF mass spectrometry to compare the proteome between lung cancer cell line A549 and its cisplatin-resistant subline
Prahlad V Raninga et al.
Apoptosis : an international journal on programmed cell death, 21(12), 1422-1437 (2016-10-28)
Multiple myeloma (MM) is an incurable plasma B cell malignancy. Despite recent advancements in anti-MM therapies, development of drug resistance remains a major clinical hurdle. DJ-1, a Parkinson's disease-associated protein, is upregulated in many cancers and its knockdown suppresses tumor
Canan Schumann et al.
Molecular pharmaceutics, 13(6), 2070-2083 (2016-05-14)
We report an efficient therapeutic modality for platinum resistant ovarian cancer based on siRNA-mediated suppression of a multifunctional DJ-1 protein that is responsible for the proliferation, growth, invasion, oxidative stress, and overall survival of various cancers. The developed therapeutic strategy
Chih-Ru Lin et al.
American journal of physiology. Lung cellular and molecular physiology, 317(6), L791-L804 (2019-07-18)
Pulmonary emphysema is characterized by alveolar type II (ATII) cell death, destruction of alveolar wall septa, and irreversible airflow limitation. Cigarette smoke induces oxidative stress and is the main risk factor for this disease development. ATII cells isolated from nonsmokers
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.