Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU113611

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXO3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TATGCAAACCCTCTCGGACTCTCTCTCAGGCTCCTCCTTGTACTCAACTAGTGCAAACCTGCCCGTCATGGGCCATGAGAAGTTCCCCAGCGACTTGGACCTGGACATGTTCAATGGGAGCTTGGAATGTGACATGGAGTCCATTATCCGTAGTGAACTCATGGATGCTGATGGGTTGGATTTTAACTTTGATTCCCTCATCTCCACACAGAATGTTGTTGGTTTGAACGTGGGGAACTTCACTGGTGCTAAGCAGGCCTCATCTCAGAGCTGGGTGCCAGGCTGAAGGATCACTGAGGAAGGGGAAGTGGGCAAAGCAGACCCTCAAACTGACACAAGACCTACAGAGAAAACCCTTTGCCAAATCTGCTCTCAGCAAGTGGACAGTGATACCGTTTACAGCTTAACACCTTTGTGAATCCCACGCCATTTTCCTAACCCAGCAGAGACTGTTAATGGCCC

N° accesso Ensembl | uomo

ENSG00000118689

N° accesso NCBI

NM_001455

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FOXO3(2309) , FOXO3(2309)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ning Liu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 66(7), 603-610 (2017-04-13)
Fibroblast-like synoviocytes (FLS) play an essential role in the pathogenesis of chronic inflammatory diseases, such as rheumatoid arthritis. Paeonol (Pae) is a phenolic compound found in many traditional Chinese medicine remedies. However, the effects of Pae on TNF-α-stimulated FLS and
M Kumazoe et al.
Oncogene, 36(19), 2643-2654 (2016-11-29)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most fatal types of cancer and the 5-year survival rate is only 5%. Several studies have suggested that cancer stem cells (CSCs) are thought to be involved in recurrence and metastasis and
Yanqiu Wang et al.
Biochemical and biophysical research communications, 524(3), 756-763 (2020-02-10)
Intervertebral disc degeneration (IDD) is typically accompanied by a reduced nutrient supply, which is thought to be a contributor to the apoptosis of nucleus pulposus cells (NPCs). Here, we explored whether Forkhead box O3 (FOXO3), a key transcription factor involved
Fei Wang et al.
Folia histochemica et cytobiologica, 58(1), 1-8 (2020-02-01)
Osteoarthritis (OA) is the most common degenerative disease in middle-aged and elderly individuals that causes joint deformity and limb disability. Accumulating evidence has suggested that the pathogenesis of OA has been related to various mechanisms such as apoptosis, inflammation, oxidative
Huaping Zhang et al.
Toxicology letters, 277, 115-122 (2017-07-10)
The antioxidant activity of genistein is associated with preventing atherosclerosis; however, the underlying mechanisms are not fully understood. In this study, human umbilical vein endothelial cells (HUVECs) were pretreated with genistein at different concentrations (10nM, 100nM and 1000nM) for 6h
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.