Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU099881

Sigma-Aldrich

MISSION® esiRNA

targeting human FN1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACACCTTCGGGGGAAATAATTCCTGTGAATATTCTTTTTCAATTCAGCAAACATTTGAAAATCTATGATGTGCAAGTCTAATTGTTGATTTCAGTACAAGATTTTCTAAATCAGTTGCTACAAAAACTGATTGGTTTTTGTCACTTCATCTCTTCACTAATGGAGATAGCTTTACACTTTCTGCTTTAATAGATTTAAGTGGACCCCAATATTTATTAAAATTGCTAGTTTACCGTTCAGAAGTATAATAGAAATAATCTTTAGTTGCTCTTTTCTAACCATTGTAATTCTTCCCTTCTTCCCTCCACCTTTC

N° accesso Ensembl | uomo

ENSG00000115414

N° accesso NCBI

NM_212474

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FN1(2335) , FN1(2335)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
UTU
WRU
UPU
QCS
KXT

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wenzhong Yi et al.
Oncology reports, 36(6), 3145-3153 (2016-10-18)
Fibronectin is a glycoprotein of the extracellular matrix, and regulates the processes of self-renewal and cell cycle progression. This study aimed to investigate fibronectin expression in colorectal cancer (CRC) and elucidate the effects of fibronectin on CRC by using a
Ulrich Blache et al.
EMBO reports, 19(8) (2018-07-04)
The fate of mesenchymal stem cells (MSCs) in the perivascular niche, as well as factors controlling their fate, is poorly understood. Here, we study MSCs in the perivascular microenvironment of endothelial capillaries by modifying a synthetic 3D biomimetic poly(ethylene glycol)
Najla El-Hachem et al.
Cell death and differentiation, 25(11), 2010-2022 (2018-03-09)
HACE1 is an E3 ubiquitin ligase described as a tumour suppressor because HACE1-knockout mice develop multi-organ, late-onset cancers and because HACE1 expression is lost in several neoplasms, such as Wilms' tumours and colorectal cancer. However, a search of public databases
Shuye Yu et al.
Oncogene, 39(27), 5042-5055 (2020-06-11)
Guanylate-binding protein 2 (GBP2) is an interferon-inducible large GTPase which is crucial to the protective immunity against microorganisms. However, its biological function in cancer remains largely unknown. Glioblastoma multiforme (GBM) is the most common and deadly brain tumor in adults.
Changgeng Xu et al.
Molecular medicine reports, 13(1), 901-908 (2015-12-10)
Lefty is a member of the transforming growth factor (TGF) β superfamily, which is implicated in left‑right patterning during embryogenesis. Previous studies revealed that lefty attenuates the epithelial‑mesenchymal transition in tubular epithelial cells. In the present study, the protective effect
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.