Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU097551

Sigma-Aldrich

MISSION® esiRNA

targeting human TET3 (1)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCTTTGGTTGTTCCTGGAGCATGTACTTCAACGGCTGCAAGTATGCTCGGAGCAAGACACCTCGCAAGTTCCGCCTCGCAGGGGACAATCCCAAAGAGGAAGAAGTGCTCCGGAAGAGTTTCCAGGACCTGGCCACCGAAGTCGCTCCCCTGTACAAGCGACTGGCCCCTCAGGCCTATCAGAACCAGGTGACCAACGAGGAAATAGCGATTGACTGCCGTCTGGGGCTGAAGGAAGGACGGCCCTTCGCGGGGGTCACGGCCTGCATGGACTTCTGTGCCCACGCCCACAAGGACCAGCATAACCTCTACAATGGGTGCACC

N° accesso Ensembl | uomo

ENSG00000187605

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TET3(200424) , TET3(200424)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Liang-Qi Cao et al.
Molecular cancer, 18(1), 148-148 (2019-10-28)
As an important means of communication, exosomes play an important role in the development of hepatocellular carcinoma (HCC). Bioinformatics analysis, dual-luciferase reporter assays, methylation-specific quantitative PCR, and ChIP-PCR analysis were used to gain insight into the underlying mechanism of miR-21
Jie Li et al.
Journal of Cancer, 12(1), 207-216 (2021-01-05)
Background: Berberine, as an alkaloid, has a significant antitumor effect, but its mechanism in tumor metabolism, especially the Warburg effect has not been elucidated. Objectives: To study the molecular mechanism of berberine regulating the Warburg effect in ovarian cancer cells.
Suhas S Kharat et al.
Science signaling, 13(645) (2020-08-21)
Synthetic lethality between poly(ADP-ribose) polymerase (PARP) inhibition and BRCA deficiency is exploited to treat breast and ovarian tumors. However, resistance to PARP inhibitors (PARPis) is common. To identify potential resistance mechanisms, we performed a genome-wide RNAi screen in BRCA2-deficient mouse

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.