Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU097521

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXP2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TACCAGAAGCGAAGGTCACAAAAGATAACAGGAAGTCCAACCTTAGTAAAAAATATACCTACCAGTTTAGGCTATGGAGCAGCTCTTAATGCCAGTTTGCAGGCTGCCTTGGCAGAGAGCAGTTTACCTTTGCTAAGTAATCCTGGACTGATAAATAATGCATCCAGTGGCCTACTGCAGGCCGTCCACGAAGACCTCAATGGTTCTCTGGATCACATTGACAGCAATGGAAACAGTAGTCCGGGCTGCTCACCTCAGCCGCACATACATTCAATCCACGTCAAGGAAGAGCCAGTGATTGCAGAGGATGAAGACTGCCCAATGT

N° accesso Ensembl | uomo

ENSG00000128573

N° accesso NCBI

NM_148899

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FOXP2(93986) , FOXP2(93986)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

W-X Wang et al.
European review for medical and pharmacological sciences, 23(15), 6467-6477 (2019-08-06)
Colorectal carcinoma (CRC) is a common malignant tumor of the digestive tract that occurs in the colon, and the incidence is the third in the gastrointestinal tumor. Recently, the dysregulated expression of microRNA-9 (miR-9) has been identified in many human
Yixiao Liu et al.
International journal of molecular sciences, 21(6) (2020-03-19)
Diabetes mellitus is a growing global health issue nearly across the world. Diabetic patients who are prone to develop diabetes-related complications often exhibit progressive neuropathy (painless and sensory loss). It is usual for small wounds to progress to ulceration, which

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.