Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU094691

Sigma-Aldrich

MISSION® esiRNA

targeting human CD44

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTAAAGGGATTCCCATCATTGGAATCTTATCACCAGATAGGCAAGTTTATGACCAAACAAGAGAGTACTGGCTTTATCCTCTAACCTCATATTTTCTCCCACTTGGCAAGTCCTTTGTGGCATTTATTCATCAGTCAGGGTGTCCGATTGGTCCTAGAACTTCCAAAGGCTGCTTGTCATAGAAGCCATTGCATCTATAAAGCAACGGCTCCTGTTAAATGGTATCTCCTTTCTGAGGCTCCTACTAAAAGTCATTTGTTACCTAAACTTATGTGCTTAACAGGCAATGCTTCTCAGACCACAAAGCAGAAAGAAGAAGAAAAGCTCCTGACTAAATCAGGGCTGGGCTT

N° accesso Ensembl | uomo

ENSG00000026508

N° accesso NCBI

NM_001001391

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CD44(960) , CD44(960)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zenghui Fang et al.
Experimental cell research, 382(1), 111462-111462 (2019-06-14)
Scaffolding adaptor Gab2 is overexpressed in a subset of high-grade ovarian cancer. Our published work shows that Gab2 via PI3K enhances migratory behaviors and epithelial to mesenchymal transition (EMT) features of ovarian cancer cells in vitro. However, it is still
Yunhee Cho et al.
Oncotarget, 6(11), 8709-8721 (2015-04-25)
CD44 plays a role in the progression of tumors and is expressed in cancer stem cells (CSCs). However, the mechanisms underlying the crosstalk of CD44 with stemness genes in CSC maintenance remains unclear. In this study, we demonstrated how the
Lu-Lu Wang et al.
Biomaterials, 141, 13-28 (2017-07-01)
Small active RNA (saRNA)-induced gene activation (RNAa) is a novel strategy to treat cancer. Our previous work proved that the p21-saRNA-322 successfully hindered colorectal cancer growth by activating p21 gene. However, the barrier for successful saRNA therapy is lack of
Wenzhe Li et al.
Scientific reports, 7(1), 13856-13856 (2017-10-25)
CD44/CD24 and ALDH1 are widely used cancer stem cell (CSC) markers in breast cancer. However, their expression is not always consistent even in the same subtype of breast cancer. Systematic comparison of their functions is still lacking. We investigated the
Shan Hwu Chew et al.
Free radical biology & medicine, 106, 91-99 (2017-02-12)
CD44 exists as a standard (CD44s) isoform and different variant isoforms (CD44v) due to alternative splicing. While the complex nature of these different isoforms has not been fully elucidated, CD44v expression has been shown to exert oncogenic effects by promoting
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.