Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU094591

Sigma-Aldrich

MISSION® esiRNA

targeting human MYB

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGCAGTAGAGCTTGGACAGAAAGAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTTTCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATACAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTTTTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCCTGTGTT

N° accesso Ensembl | uomo

ENSG00000118513

N° accesso NCBI

NM_005375

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MYB(4602) , MYB(4602)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yue Wang et al.
Cancer letters, 385, 234-242 (2016-10-25)
The oncoprotein Yes-associated protein (YAP) in Hippo pathway plays crucial roles in the development of cancer. However, the mechanism of YAP regulation in cancer remains poorly understood. Here, we supposed that the oncoprotein hepatitis B X-interacting protein (HBXIP) might be
Tian Lan et al.
Cancer research, 79(13), 3220-3234 (2019-05-19)
Understanding the roles of noncoding RNAs (ncRNA) in tumorigenesis and metastasis would establish novel avenues to identify diagnostic and therapeutic targets. Here, we aimed to identify hepatocellular carcinoma (HCC)-specific ncRNA and to investigate their roles in hepatocarcinogenesis and metastasis. RNA-seq
Andrej Gorbatenko et al.
Scientific reports, 9(1), 3352-3352 (2019-03-06)
The HER2 oncogene and its truncated form p95HER2 play central roles in breast cancer. Here, we show that although HER2 and p95HER2 generally elicit qualitatively similar changes in miRNA profile in MCF-7 breast cancer cells, a subset of changes are
Sapana Jalnapurkar et al.
Stem cell research & therapy, 7(1), 171-171 (2016-11-24)
The success of hematopoietic stem cell (HSC) transplantation is dependent on the quality of the donor HSCs. Some sources of HSCs display reduced engraftment efficiency either because of inadequate number (e.g., fetal liver and cord blood), or age-related dysfunction (e.g.
Xuefeng Li et al.
Nature microbiology, 1(10), 16132-16132 (2016-09-28)
MicroRNAs (miRNAs) play critical roles in various biological processes, including cell proliferation, development and host defence. However, the molecular mechanism for miRNAs in regulating bacterial-induced inflammation remains largely unclear. Here, we report that miR-301b augments pro-inflammatory response during pulmonary infection
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.