Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU094011

Sigma-Aldrich

MISSION® esiRNA

targeting human ITPR1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGCTGACCTGAGGAGTGAGAAGCAGAAGAAGGAAGAGATCTTGAAGACCACGTGCTTTATCTGTGGCTTGGAAAGAGACAAGTTTGACAACAAGACTGTCACCTTTGAAGAGCACATCAAGGAAGAACACAACATGTGGCACTATCTGTGCTTCATCGTCCTGGTGAAAGTAAAGGACTCCACCGAATATACTGGGCCTGAGAGTTACGTGGCAGAAATGATCAAGGAAAGAAACCTTGACTGGTTCCCCAGGATGAGAGCCATGTCATTGGTCAGCAGTGATTCTGAAGGAGAACAGAATGAGCTGAGAAACCTGCAGGAGAAGCTGGAGTCCACCATGAAACTTGTCACGAACCTTTCTGGCCAGCTGTCGGAATTAAAGGATCAGATGACAGAACAAAGGAAGCAGAAACAAAGAATTGG

N° accesso Ensembl | uomo

ENSG00000150995

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ITPR1(3708) , ITPR1(3708)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ting Yu et al.
Experimental cell research, 399(2), 112438-112438 (2020-12-29)
Palmitic acid (PA)-induced hepatocyte apoptosis is critical for the progression of nonalcoholic fatty liver disease (NAFLD). Inositol 1,4,5-trisphosphate receptor type 1 (IP3R1) is an intracellular Ca2+-release channel and is involved in PA-induced hepatocyte apoptosis. While the expression of IP3R1 is
Jie Tong et al.
Biochimica et biophysica acta, 1864(12), 2389-2401 (2017-10-01)
The mechanism by which cell shape regulates the function of the cell is one of the most important biological issues, but it remains unclear. Here, we investigated the effect of the regulation of cell shape on proliferation by using a
Yi-Dong Yang et al.
Journal of cellular biochemistry, 120(11), 18967-18978 (2019-06-27)
Mitochondrial dysfunction plays a principal role in hypoxia-induced endothelial injury, which is involved in hypoxic pulmonary hypertension and ischemic cardiovascular diseases. Recent studies have identified mitochondria-associated membranes (MAMs) that modulate mitochondrial function under a variety of pathophysiological conditions such as high-fat diet-mediated
Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Vishal R Yadav et al.
American journal of physiology. Lung cellular and molecular physiology, 314(5), L724-L735 (2018-02-02)
Hypoxia-induced pulmonary vasoconstriction (HPV) is attributed to an increase in intracellular Ca2+ concentration ([Ca2+]i) in pulmonary artery smooth muscle cells (PASMCs). We have reported that phospholipase C-γ1 (PLCγ1) plays a significant role in the hypoxia-induced increase in [Ca2+]i in PASMCs
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.