Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU091571

Sigma-Aldrich

MISSION® esiRNA

targeting human CADM1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGTGATGGGCAGAATCTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGTGACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTGAAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCAATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATCACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAGATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAAC

N° accesso Ensembl | uomo

ENSG00000182985

N° accesso NCBI

NM_014333

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CADM1(23705) , CADM1(23705)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Richard Hunte et al.
PLoS pathogens, 14(4), e1006968-e1006968 (2018-04-27)
Approximately 12% of all human cancers worldwide are caused by infections with oncogenic viruses. Kaposi's sarcoma herpesvirus/human herpesvirus 8 (KSHV/HHV8) is one of the oncogenic viruses responsible for human cancers, including Kaposi's sarcoma (KS), Primary Effusion Lymphoma (PEL), and the
Shu-Jun Wang et al.
Molecular medicine reports, 22(5), 3795-3803 (2020-10-02)
Melanoma is a malignant skin cancer type associated with a high mortality rate, but its treatment is currently not ideal. Both microRNA (miR)‑214 and cell adhesion molecule 1 (CADM1) are differentially expressed in melanoma, but their role in this cancer type
Hye-Ran Kim et al.
Frontiers in immunology, 11, 591054-591054 (2021-02-19)
A robust T-cell response is an important component of sustained antitumor immunity. In this respect, the avidity of TCR in the antigen-targeting of tumors is crucial for the quality of the T-cell response. This study reports that the transmembrane (TM)
Peter J Chockley et al.
The Journal of clinical investigation, 128(4), 1384-1396 (2018-01-13)
During epithelial-mesenchymal transition (EMT) epithelial cancer cells transdifferentiate into highly motile, invasive, mesenchymal-like cells, giving rise to disseminating tumor cells. Few of these disseminated cells successfully metastasize. Immune cells and inflammation in the tumor microenvironment were shown to drive EMT

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.