Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU091461

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCAGACTTGGTTCCTTCAACCTAGAGAAAGTTGAAAACCCAGCTGAAGTCATTAGAGAACTTATTTGTTATTGCTTGGACACCATTGCAGAAAATCAAGCCAAAAATGAGCACCTGCAGAAAGAAAATGAAAGGCTTCTGAGAGATTGGAATGATGTTCAAGGACGATTTGAAAAATGTGTGAGTGCTAAGGAAGCTTTGGAGACTGATCTTTATAAGCGGTTTATTCTGGTGTTGAATGAGAAGAAAACAAAAATCAGAAGTTTGCATAATAAATTATTAAATGCAGCTCAAGAACGAGAAAAGGACATCAAACAAGAAGGGGAAACTGCAATCTGTTCTGAAATGACTGCTGACCGAGATCCAGTCTATGATGAGAGTACTGATGAGGAAAGTGAAAACCAAACTGATCTCTCTGGGTTGGCTT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wen Li et al.
Nature cell biology, 21(10), 1273-1285 (2019-09-25)
Chromosome translocation is a major cause of the onset and progression of diverse types of cancers. However, the mechanisms underlying this process remain poorly understood. Here, we identified a non-homologous end-joining protein, IFFO1, which structurally forms a heterotetramer with XRCC4.
Idit Hazan et al.
Cell reports, 29(3), 560-572 (2019-10-17)
DNA double-strand breaks (DSBs) are deleterious and tumorigenic but could also be essential for DNA-based processes. Yet the landscape of physiological DSBs and their role and repair are still elusive. Here, we mapped DSBs at high resolution in cancer and
Masahiro Terasawa et al.
PLoS genetics, 10(8), e1004563-e1004563 (2014-08-29)
DNA double-strand breaks (DSBs) can be repaired by one of two major pathways-non-homologous end-joining (NHEJ) and homologous recombination (HR)-depending on whether cells are in G1 or S/G2 phase, respectively. However, the mechanisms of DSB repair during M phase remain largely

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.