Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU081661

Sigma-Aldrich

MISSION® esiRNA

targeting human NTRK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGCCTGCCTCTTCCTTTCTACGCTGCTCCTTGTGCTCAACAAATGTGGACGGAGAAACAAGTTTGGGATCAACCGCCCGGCTGTGCTGGCTCCAGAGGATGGGCTGGCCATGTCCCTGCATTTCATGACATTGGGTGGCAGCTCCCTGTCCCCCACCGAGGGCAAAGGCTCTGGGCTCCAAGGCCACATCATCGAGAACCCACAATACTTCAGTGATGCCTGTGTTCACCACATCAAGCGCCGGGACATCGTGCTCAAGTGGGAGCTGGGGGAGGGCGCCTTTGGGAAGGTCTTCCTTGCTGAGTGCCACAACCTCCTGCCTGAGCAGGACAAGATGCTGGTGGCTGTCAAGGCACTGAAGGAGGCGTCCGAGAGTGCTCGGCAGGACTTCCAGCGTGAGGCTG

N° accesso Ensembl | uomo

ENSG00000198400

N° accesso NCBI

NM_001012331

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NTRK1(4914) , NTRK1(4914)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Marzia Di Donato et al.
Cancers, 11(6) (2019-06-09)
Resistance to hormone therapy and disease progression is the major challenge in clinical management of prostate cancer (PC). Drugs currently used in PC therapy initially show a potent antitumor effects, but PC gradually develops resistance, relapses and spreads. Most patients
Sam Faulkner et al.
The American journal of pathology, 188(1), 229-241 (2017-10-19)
Neurotrophin receptors are emerging targets in oncology, but their clinicopathologic significance in thyroid cancer is unclear. In this study, the neurotrophin tyrosine receptor kinase TrkA (also called NTRK1), the common neurotrophin receptor p75NTR, and the proneurotrophin receptor sortilin were analyzed
Xinyuan Yang et al.
Oncogene, 38(15), 2778-2787 (2018-12-14)
Multiple cancer signalling networks take part in regulatory crosstalks with the Hippo tumour suppressor pathway through the transcriptional cofactor Yes-associated protein (YAP). Nevertheless, how YAP is controlled by pathway crosstalks in tumourigenesis remains poorly understood. Here, we performed a targeted
Wenyu Shi et al.
Molecular oncology, 11(9), 1189-1207 (2017-05-31)
Nucleophosmin-anaplastic lymphoma kinase-expressing (NPM-ALK+ ) T-cell lymphoma is an aggressive neoplasm that is more commonly seen in children and young adults. The pathogenesis of NPM-ALK+ T-cell lymphoma is not completely understood. Wild-type ALK is a receptor tyrosine kinase that is
M Rochman et al.
Mucosal immunology, 8(4), 785-798 (2014-11-13)
Although interleukin (IL)-13 and neurotrophins are functionally important for the pathogenesis of immune responses, the interaction of these pathways has not been explored. Herein, by interrogating IL-13-induced responses in human epithelial cells we show that neurotrophic tyrosine kinase receptor, type

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.