Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU081471

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1I2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGTGTCTCTGCATCCATTTGAACACATTATTAAGCACCGATAATAGGTAGCCTGCTGTGGGGTATACAGCATTGACTCAGATATAGATCCTGAGCTCACAGAGTTTATAGTTAAAAAAACAAACAGAAACACAAACGATTTGGATCAAAAGGAGAAATGATAAGTGACAAAAGCAGCACAAGGAATTTCCCTGTGTGGATGCTGAGCTGTGATGGCGGGCACTGGGTACCCAAGTGAAGGTTCCCAAGGACATGAGTCTGTAGGAGCAAGGGCACAAACTGCAGCTGTGAGTGCGTGTGTGTGATTTGGTGTAGGTAGGTCTGTTTGCCACTTGATGGGGCCTGGGTTTGTTCCTGGGGCTGGAATGCTGGGTATGCTCTGTGACAAGGCTACGCTGACAATCA

N° accesso Ensembl | uomo

ENSG00000144852

N° accesso NCBI

NM_022002

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NR1I2(8856) , NR1I2(8856)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wenjing Luo et al.
British journal of pharmacology, 174(8), 700-717 (2017-01-28)
Imatinib mesylate (IM) is a first-line treatment for chronic myeloid leukaemia (CML) as a specific inhibitor of BCR-ABL tyrosine kinase. As IM is widely used in CML, in combination with other drugs, the effects of IM on drug-metabolizing enzymes (DMEs)
Yan Chen et al.
Cancer medicine, 5(12), 3564-3571 (2016-11-24)
Cytochrome P450 2C8 (CYP2C8) is one of the enzymes that primarily participate in producing metabolisms of medications and P-glycoprotein (P-gp) has been regarded as one of the important molecules in chemotherapeutically induced multidrug resistance (MDR). In addition, the pregnane X
M Semeniuk et al.
Archives of toxicology, 94(5), 1625-1635 (2020-03-19)
P-glycoprotein (P-gp) is an ABC transporter exhibiting high pharmacotoxicological relevance by extruding a wide range of cytotoxic compounds out of the cells. Previously, we demonstrated that the phytoestrogen genistein (GNT) modulates P-gp expression in hepatocellular carcinoma in vitro. Although several
Yiqiang Xie et al.
Pakistan journal of pharmaceutical sciences, 31(5(Special)), 2315-2321 (2018-11-23)
Feng-Liao-Chang-Wei-Kang (FLCWK), a traditional Chinese patent medicine, consists primarily of Polygonum hydropiper and Daphniphyllum calycinum roots. As a complex containing several kinds of flavonoids, FLCWK has the potential to impact the drug metabolism enzyme P450 3A4 (CYP3A4) and nuclear receptors.
Liming Chen et al.
Molecular pharmacology, 94(1), 749-759 (2018-04-25)
Cytochrome P450 (P450) enzymes are responsible for metabolizing drugs. Expression of P450s can directly affect drug metabolism, resulting in various outcomes in therapeutic efficacy and adverse effects. Several nuclear receptors are transcription factors that can regulate expression of P450s at
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.