Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU080431

Sigma-Aldrich

MISSION® esiRNA

targeting human NCL

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATAGAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAGAGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTA

N° accesso Ensembl | uomo

ENSG00000115053

N° accesso NCBI

NM_005381

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NCL(4691) , NCL(4691)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Applicazioni

MISSION® esiRNA has been used for transfection of cells to target nucleolin.

Azioni biochim/fisiol

NCL (nucleolin) is ribonucleoprotein, mainly involved in ribosomal biogenesis. Additionally, it is linked with cell differentiation and proliferation, stress-conditioned responses and cellular shuttling. This gene is upregulated in cancer cells. In cancer cells, it is associated with progression and is mainly present on the membrane of cancer cells. On the membrane, it binds to tumor promoting proteins.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Nucleolin antagonist triggers autophagic cell death in human glioblastoma primary cells and decreased in vivo tumor growth in orthotopic brain tumor model.
Benedetti E
Oncotarget, 6, 42091-42091 (2015)
Fengfei Wang et al.
Journal of the American Chemical Society, 141(8), 3613-3622 (2019-01-29)
The aim of this study is to illuminate a novel therapeutic approach by identifying a functional binding target of salinomycin, an emerging anticancer stem cell (CSC) agent, and to help dissect the underlying action mechanisms. By utilizing integrated strategies, we
Nucleolin-binding by ErbB2 enhances tumorigenicity of ErbB2-positive breast cancer.
Wolfson E
Oncotarget, 7, 65320-65320 (2016)
Zoi Diamantopoulou et al.
Oncotarget, 8(52), 90108-90122 (2017-11-23)
In this study, a novel anticancer reagent based on polyplexes nanoparticles was developed. These nanoparticles are obtained by mixing negatively charged polyelectrolytes with the antitumour cationically-charged pseudopeptide N6L. Using two
Quantitative Cell Cycle Analysis Based on an Endogenous All-in-One Reporter for Cell Tracking and Classification.
Zerjatke T
Cell Reports, 19, 1953-1953 (2017)
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.