Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU077471

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACTACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCCACATCAAGA

N° accesso Ensembl | uomo

ENSG00000105221

N° accesso NCBI

NM_001626

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... AKT2(208) , AKT2(208)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wanmu Xie et al.
Journal of thrombosis and thrombolysis, 50(1), 98-111 (2020-05-03)
Venous thromboembolism (VTE) carries a high risk of morbidity and mortality. Understanding the mechanisms of venous thrombus formation and resolution is critical for improving VTE management. AKT2 kinase is essential for platelet activation and arterial thrombosis. In this study, we
Mohammad Imran Khan et al.
Molecular cancer therapeutics, 18(2), 356-363 (2018-11-18)
Hyperactivated AKT kinase due to loss of its negative regulator PTEN influences many aspects of cancer biology, including chromatin. AKT primarily regulates acetyl-CoA production and phosphorylates many histone-modulating enzymes, resulting in their activation or inhibition. Therefore, understanding the therapeutic impact
Yong Cui et al.
OncoTargets and therapy, 8, 1681-1690 (2015-07-18)
The AKT2 kinase (protein kinase Bβ) is overexpressed in high-grade gliomas. Upregulation of the AKT2 gene has been previously observed in glioblastoma patients suffering from chemotherapy failure and tumor progress. In this study, we aimed to evaluate the effect of
Yang Sun et al.
PloS one, 10(4), e0119783-e0119783 (2015-04-10)
Aberrant microRNA (miRNA) expression is associated with tumor development. This study aimed to elucidate the role of miR-615-5p in the development of pancreatic ductal adenocarcinoma (PDAC). Locked nucleic acid in situ hybridization (LNA-ISH) was performed to compare miR-615-5p expression in
Dineo Khabele et al.
Journal of Cancer, 5(8), 670-678 (2014-09-27)
Overexpression of the epidermal growth factor receptor (EGFR) is associated with the malignant phenotype in many cancers including ovarian cancer, which leads to increased cell proliferation and survival. In spite of emerging EGFR inhibitors as a potentially useful agent, they
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.