Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU075501

Sigma-Aldrich

MISSION® esiRNA

targeting human CUX1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGCAAGGAAGCTGAAGCAGCTTTCTTGAATGTCTACAAAAGATTGATTGACGTCCCAGATCCCGTACCAGCTTTGGATCTCGGACAGCAACTCCAGCTCAAAGTGCAGCGCCTGCACGATATTGAAACAGAGAACCAGAAACTTAGGGAAACTCTGGAAGAATACAACAAGGAATTTGCTGAAGTGAAAAATCAAGAGGTTACGATAAAAGCACTTAAAGAGAAAATCCGAGAATATGAACAGACACTGAAGAACCAAGCCGAAACCATAGCTCTTGAGAAGGAACAGAAGTTACAGAATGACTTTGCAGAAAAGGAGAGAAAGCTGCAGGAGACACAGATGTCCACCACCTCAAAGCTGGAGGAAGCTGAGCATAAGGTTCAGAGCCTACAAACAGCCCTGGAAA

N° accesso Ensembl | uomo

ENSG00000160967

N° accesso NCBI

NM_001913

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CUX1(1523) , CUX1(1523)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Liza J Burton et al.
PloS one, 14(4), e0214844-e0214844 (2019-04-10)
Triple-Negative Breast Cancers (TNBCs) are the most difficult to treat subtype of breast cancer and are often associated with high nuclear expression of Snail and Cathepsin L (Cat L) protease. We have previously shown that Snail can increase Cat L
Xiao Zhang et al.
Neurochemical research, 45(12), 2840-2855 (2020-10-02)
Circular RNAs (circRNAs) played pivotal roles in the initiation and progression of cancers. CircRNA cut like homeobox 1 (circ-CUX1; hsa_circ_0132813) has been reported to contribute to neuroblastoma (NB) development by previous study. Furthermore, previous works reported that microRNA-16-5p (miR-16-5p) was
Junfeng Wang et al.
Oncology reports, 37(5), 3068-3074 (2017-04-14)
The homeobox transcription factor CUTL1 has been associated with cellular proliferation and cell cycle progression, and CUTL1 functions as an oncogene. The aim of the present study was to investigate whether CUTL1 participates in epithelial-mesenchymal transition (EMT). The expression levels
Tian Gao et al.
Cancer biology & medicine, 17(2), 371-386 (2020-06-27)
Objective: Osteosarcoma is a common primary highly malignant bone tumor. Kinesin family member 18B (KIF18B) has been identified as a potential oncogene involved in the development and metastasis of several cancer types. While KIF18B overexpression in osteosarcoma tissue is clearly

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.