Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU074811

Sigma-Aldrich

MISSION® esiRNA

targeting human WHRN

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGAGGCCTTCAAGACTAAGGACCGTGACTACATTGACTTTCTGGTCACTGAGTTCAATGTGATGCTCTAGAGGCCAAGGCCTGAGGGCCTCCCACCACTGCCCAGCCCCTGGTCCCAGTCCCTTTCCACCGTTGGCTTCATCAAGCTCCTTGCGGGGTTGGGGCTGCATGGCCAGGGTGGCAGGAAGACATCCCCCCTCCATCCCAGCCCACTGGACCAGAACTGGGAGAGGAAGAGAGCAGGACAAGGCAGACAGAAGGTCAGGTCAGGAACTGGTGCTGTACTGGGTACACAGTAGGCGCCCAGGACAAGTGGGTTGCAAGACAGGAAGAAAGGAAAAGGAAGGGCAGAGTGCTGGTTTCTCCAGGTTGGGTTGGGGGCACTGCTGTCCCCCCTCCAGCTAGGACCCAGCCCATCCCCAGATGCCTGAGCCTTTGTCCAAAGTGA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Fernanda C Teixeira et al.
Pharmaceutical development and technology, 25(4), 408-415 (2019-12-19)
Introduction: Glioblastoma (GB) is the most common malignant brain tumor and is characterized by high invasiveness, poor prognosis, and limited therapeutic options. Silencing gene expression, through the use of small interfering RNA (siRNA), has been proposed as an alternative to
Wuming Gong et al.
BMC bioinformatics, 7, 516-516 (2006-11-30)
Short interfering RNAs have allowed the development of clean and easily regulated methods for disruption of gene expression. However, while these methods continue to grow in popularity, designing effective siRNA experiments can be challenging. The various existing siRNA design guidelines
Avraam El Hamidieh et al.
PloS one, 7(8), e42722-e42722 (2012-08-23)
Cdc37 is a 50 kDa molecular chaperone which targets intrinsically unstable protein kinases to the molecular chaperone HSP90. It is also an over-expressed oncoprotein that mediates carcinogenesis and maintenance of the malignant phenotype by stabilizing the compromised structures of mutant
Shun Yao et al.
Cancer letters, 502, 1-8 (2020-12-07)
Angio-associated migratory cell protein (AAMP) is considered a pro-tumor protein, which contributes to angiogenesis, proliferation, adhesion, and other biological activities. Although AAMP is known to facilitate the motility of breast cancer cells and smooth muscle cells by regulating ras homolog
Ya-Jie Zhang et al.
World journal of gastroenterology, 20(25), 8229-8236 (2014-07-11)
To investigate the effect of Girdin knockdown on the chemosensitivity of colorectal cancer cells to oxaliplatin and the possible mechanisms involved. Four siRNAs targeting Girdin were transfected into the chemoresistant colorectal cancer cell line DLD1. Real-time polymerase chain reaction (PCR)

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.