Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU074691

Sigma-Aldrich

MISSION® esiRNA

targeting human GABPA

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAGAGTGCACAGAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGACAAGATGGGCTGCT

N° accesso Ensembl | uomo

ENSG00000154727

N° accesso NCBI

NM_002040

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... GABPA(2551) , GABPA(2551)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ABZO
BWU
SXT
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Limin Xu et al.
Frontiers in cell and developmental biology, 8, 569977-569977 (2020-10-31)
Cerebral ischemic injury is a complicated pathological process. Adipose-derived stromal cells (ADSCs) have been used as a therapeutic strategy, with their therapeutic effects chiefly attributed to paracrine action rather than trans-differentiation. Studies have shown that circAkap7 was found to be
Renzhe Cui et al.
Ophthalmic research, 63(4), 404-412 (2019-12-23)
Oxidative damage plays a vital role in the pathogenesis of age-related macular degeneration (AMD). Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, possesses several pharmacological functions, such as anti-inflammatory and antioxidative properties. However, the effects and mechanism of EX4 on oxidative
Lingjie Bao et al.
Molecular carcinogenesis, 56(6), 1543-1553 (2017-01-24)
Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer
Yasutaka Mitamura et al.
Oxidative medicine and cellular longevity, 2018, 2475047-2475047 (2018-09-07)
Systemic fibrosing or sclerotic disorders are life-threatening, but only very limited treatment modalities are available for them. In recent years, periostin (POSTN), a major extracellular matrix component, was established by several studies as a novel key player in the progression
Arpita Chatterjee et al.
Redox biology, 34, 101542-101542 (2020-05-04)
Radiation is a common anticancer therapy for many cancer patients, including prostate cancer. Diabetic prostate cancer patients suffer from increased lymph node metastasis, tumor recurrence and decreased survival as compared to non-diabetic prostate cancer patients. These patients are also at
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.