Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU068551

Sigma-Aldrich

MISSION® esiRNA

targeting human YTHDF2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACTTGAGTCCACAGGCAAGGCCCAATAATGCATATACTGCCATGTCAGATTCCTACTTACCCAGTTACTACAGTCCCTCCATTGGCTTCTCCTATTCTTTGGGTGAAGCTGCTTGGTCTACGGGGGGTGACACAGCCATGCCCTACTTAACTTCTTATGGACAGCTGAGCAACGGAGAGCCCCACTTCCTACCAGATGCAATGTTTGGGCAACCAGGAGCCCTAGGTAGCACTCCATTTCTTGGTCAGCATGGTTTTAATTTCTTTCCCAGTGGGATTGACTTCTCAGCATGGGGAAATAACAGTTCTCAGGGACAGTCTACTCAGAGCTCTGGATATAGTAGCAATTATGCTTATGCACCTAGCTCCTTAGGTGGAGCCATGATTGATGGACAGTCAGCTTTTGCCAATGA

N° accesso Ensembl | uomo

ENSG00000198492

N° accesso NCBI

NM_016258

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... YTHDF2(51441) , YTHDF2(51441)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chuanzhao Zhang et al.
Oncogene, 39(23), 4507-4518 (2020-05-06)
N6-methyladenosine (m6A) RNA methylation contributes to the cancer stem cell (CSC) phenotype through regulating gene expression. YTHDF2, an m6A reader, was shown to be associated with hepatocellular carcinoma (HCC) patient prognosis. However, the effect of YTHDF2 on liver CSC and
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Sara Zaccara et al.
Cell, 181(7), 1582-1595 (2020-06-04)
N6-methyladenosine (m6A) is the most abundant mRNA nucleotide modification and regulates critical aspects of cellular physiology and differentiation. m6A is thought to mediate its effects through a complex network of interactions between different m6A sites and three functionally distinct cytoplasmic
Ye Fu et al.
Nature chemical biology, 16(9), 955-963 (2020-05-27)
Diverse RNAs and RNA-binding proteins form phase-separated, membraneless granules in cells under stress conditions. However, the role of the prevalent mRNA methylation, m6A, and its binding proteins in stress granule (SG) assembly remain unclear. Here, we show that m6A-modified mRNAs
Gaocai Li et al.
Cell death & disease, 11(2), 103-103 (2020-02-08)
N6 methyladenosine (m6A) is one of the most prevalent epitranscriptomic modifications of mRNAs, and plays a critical role in various bioprocesses. Bone-derived mesenchymal stem cells (BMSCs) can attenuate apoptosis of nucleus pulposus cells (NPCs) under compression; however, the underlying mechanisms
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.