Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU068301

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTACCACCTTGGGGTGAGAGAAAGTTTCAGCATGGCCAACAACATCATCCTCTACTGTGATACTAACTCGGACTCTCTGCAGTCACTGAAGGAAATAATTTGCCAGAAGAATACTATGTGCACTGGGAACTACACCTTTGTTCCTTACATGATAACTCCACATAACAAAGTCTACTGCTGTGACAGCAGCTTCATGAAGGGGTTGACAGAGCTCATGCAACCGAACTTCGAGCTGCTTCTTGGACCCATCTGCTTACCTCTTGTGGATCGTTTTATTCAACTTTTGAAGGTGGCACAAGCAAGTTCTAGCCAGTACTTCCGGGAATCTATACTCAATGACATCAGGAAAGCTCGTAATTTATACACTGGTAAAGAATTGGCAGCTGAGTTGGCAAGAATTCGGCAGCGAGTAG

N° accesso Ensembl | uomo

ENSG00000197442

N° accesso NCBI

NM_005923

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MAP3K5(4217) , MAP3K5(4217)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
BAV
VBS
XPR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yongwei Yao et al.
Biochemical and biophysical research communications, 493(3), 1288-1295 (2017-10-03)
Interleukin-33 (IL-33), a new member of the IL-1 cytokine family, has cardiac protective effect in many circumstances. The aims of present study are to assess whether IL-33 can protect cardiomyocytes from doxorubicin (DOX)-induced apoptosis and the mechanism involved in the
Liwei Ma et al.
Journal of experimental & clinical cancer research : CR, 38(1), 77-77 (2019-02-15)
Metformin, a first-line drug for type 2 diabetes, could induce apoptosis in cancer cells. However, the concentration of glucose affects the effect of metformin, especially low glucose in the culture medium can enhance the cytotoxicity of metformin on cancer cells.
Chiara Imarisio et al.
Free radical biology & medicine, 112, 141-148 (2017-07-26)
Steatosis intensifies hepatic ischemia/reperfusion (I/R) injury increasing hepatocyte damage and hepatic inflammation. This study evaluates if this process is associated to a differential response of steatotic hepatocytes (HP) and Kupffer cells (KC) to I/R injury and investigates the molecular mechanisms
Mathew S Eapen et al.
Clinical science (London, England : 1979), 132(14), 1615-1627 (2018-07-15)
Increased airway smooth muscle (ASM) mass is observed in chronic obstructive pulmonary disease (COPD), which is correlated with disease severity and negatively affects lung function in these patients. Thus, there is clear unmet clinical need for finding new therapies which
Musarat Ishaq et al.
Biochimica et biophysica acta, 1843(12), 2827-2837 (2014-09-01)
Atmospheric pressure gas plasma (AGP) generates reactive oxygen species (ROS) that induce apoptosis in cultured cancer cells. The majority of cancer cells develop a ROS-scavenging anti-oxidant system regulated by Nrf2, which confers resistance to ROS-mediated cancer cell death. Generation of
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.