Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU065551

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP11C

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGAAAGAGCGAGAGACCTTGAAGGTTTTAAAAATGTTCACCGACTTCCTATCATTTATGGTTCTATTCAACTTTATCATTCCTGTCTCCATGTACGTCACAGTAGAAATGCAGAAATTCTTGGGCTCCTTCTTCATCTCATGGGATAAGGACTTTTATGATGAAGAAATTAATGAAGGAGCCCTGGTTAACACATCAGACCTTAATGAAGAACTTGGTCAGGTGGATTATGTATTTACAGATAAGACTGGAACACTCACTGAAAACAGCATGGAATTCATTGAATGCTGCATAGATGGCCACAAATATAAAGGTGTAACTCAAGAGGTTGATGGATTATCTCAAACTGATGGAACTTTAACATATTTTGACAAAGTAGATAAGAATCGAGAAGAGCTGTTTCTACGTGCCTTGTGTTTATGTCATACTGTAGAAATCAAAACAAACGATGCTGTTGATGGAGCTA

N° accesso Ensembl | uomo

ENSG00000101974

N° accesso NCBI

NM_001010986

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ATP11C(286410) , ATP11C(286410)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Donatien Kamdem Toukam et al.
PloS one, 7(5), e38068-e38068 (2012-06-06)
Although human immunodeficiency type 1 (HIV-1) infection induces strong antibody responses to the viral envelope glycoprotein (Env) only a few of these antibodies possess the capacity to neutralize a broad range of strains. The induction of such antibodies represents an
Theo Rispens et al.
PloS one, 8(2), e55566-e55566 (2013-02-08)
IgE antibodies to gal-α-1,3-gal-β-1,4-GlcNAc (α-gal) can mediate a novel form of delayed anaphylaxis to red meat. Although IgG antibodies to α-gal (anti-α-gal or anti-Gal) are widely expressed in humans, IgE anti-α-gal is not. We explored the relationship between the IgG
Pallara Janardhanan Wills et al.
PloS one, 11(4), e0152787-e0152787 (2016-04-14)
Lepidopterism is a disease caused by the urticating scales and toxic fluids of adult moths, butterflies or its caterpillars. The resulting cutaneous eruptions and systemic problems progress to clinical complications sometimes leading to death. High incidence of fever epidemics were
Alessandra Ghiani et al.
PloS one, 11(5), e0155803-e0155803 (2016-05-18)
Tomato (Solanum lycopersicum) is one of the most extensively consumed vegetables but, unfortunately, it is also able to induce allergic reactions. In the past, it has been shown that the choice of tomato cultivar significantly influenced the allergic reaction of
Li-Te Chin et al.
BMC biotechnology, 7, 51-51 (2007-08-24)
The ability to acquire fully human monoclonal antibodies (mAbs) with pre-defined specificities is critical to the development of molecular tags for the analysis of receptor function in addition to promising immunotherapeutics. Yet most of the arriving affinity maturated and complete
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.