Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU062441

Sigma-Aldrich

MISSION® esiRNA

targeting human SEPT9

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGCCAGGAGGCCACTGAGGCGGCTCCCAGCTGCGTTGGCGACATGGCCGACACCCCCAGAGATGCCGGGCTCAAGCAGGCGCCTGCATCACGGAACGAGAAGGCCCCGGTGGACTTCGGCTACGTGGGGATTGACTCCATCCTGGAGCAGATGCGCCGGAAGGCCATGAAGCAGGGCTTCGAGTTCAACATCATGGTGGTCGGGCAGAGCGGCTTGGGTAAATCCACCTTAATCAACACCCTCTTCAAATCCAAAATCAGCCGGAAGTCGGTGCAGCCCACCTCAGAGGAGCGCATCCCCAAGACCATCGAGATCAAGTCCATCACGCACGATATTGAGGAGAAAGGCGTCCGGATGAAGCTGACAGTGATTGACACACCAGGGTTCGGGGACCACATCAACAACGAGAACTGCTGG

N° accesso Ensembl | uomo

ENSG00000184640

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SEPT9(10801) , SEPT9(10801)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Beatrice Stubendorff et al.
Journal of cancer research and clinical oncology, 145(4), 811-820 (2019-01-04)
In this study, we aimed to identify a DNA methylation pattern suitable for prognosis assessment of muscle-invasive bladder cancer and to investigate metastasis-associated processes regulated by DNA methylation. Genome-wide methylation analysis was performed on 23 muscle-invasive bladder tumors by microarray
Forooz Soroor et al.
Molecular biology of the cell, 32(3), 289-300 (2020-12-03)
Septins are conserved GTP-binding cytoskeletal proteins that polymerize into filaments by end-to-end joining of hetero-oligomeric complexes. In human cells, both hexamers and octamers exist, and crystallography studies predicted the order of the hexamers to be SEPT7-SEPT6-SEPT2-SEPT2-SEPT6-SEPT7, while octamers are thought
Guodong Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 109768-109768 (2020-02-29)
Malignant glioma is a highly aggressive cancer, known as one of the most dangerous types of primary brain tumor occurring in the central nervous system (CNS). Septin 9 (SEPT9) has been involved in tumor growth. However, its exact roles in
Ilona A Kesisova et al.
The Journal of cell biology, 220(2) (2021-01-09)
The metabolic and signaling functions of lysosomes depend on their intracellular positioning and trafficking, but the underlying mechanisms are little understood. Here, we have discovered a novel septin GTPase-based mechanism for retrograde lysosome transport. We found that septin 9 (SEPT9)

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.