Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU061411

Sigma-Aldrich

MISSION® esiRNA

targeting human PLXNB2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTTCTTCCTGCCCTCCAAGGACGGCGACAAGGACGTGATGATCACCGGCAAGCTGGACATCCCTGAGCCGCGGCGGCCGGTGGTGGAGCAGGCCCTCTACCAGTTCTCCAACCTGCTGAACAGCAAGTCTTTCCTCATCAATTTCATCCACACCCTGGAGAACCAGCGGGAGTTCTCGGCCCGCGCCAAGGTCTACTTCGCGTCCCTGCTGACGGTGGCGCTGCACGGGAAACTGGAGTACTACACGGACATCATGCACACGCTCTTCCTGGAGCTCCTGGAGCAGTACGTGGTGGCCAAGAACCCCAAGCTGATGCTGCGCAGGTCTGAGACTGTGGTGGAGAGGATGCTGTCCAACTGGATGTCCATCTGCCTGTACCAGTACCTCAAGGACAGTGCCGGGGAGCCCCTGTACAAGCTCTTCAAGGCCATCAAACATCAGGTGGAAAAGGGCCCGGTGGATGCGGTACAGAAGAAGGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Brad McColl et al.
Journal of cell science, 129(21), 4046-4056 (2016-11-03)
Rnd proteins are atypical members of the Rho GTPase family that induce actin cytoskeletal reorganization and cell rounding. Rnd proteins have been reported to bind to the intracellular domain of several plexin receptors, but whether plexins contribute to the Rnd-induced
Ying Zhang et al.
Cellular signalling, 62, 109343-109343 (2019-06-10)
Plexin-B2 (PLXNB2), a transmembrane protein is found in various tissues. Recent studies have indicated the presence of PLXNB2 in large quantity in the growth plates of Sprague-Dawley rats and are believed to be potentially involved in their skeletal development. This
Audrey P Le et al.
Oncotarget, 6(9), 7293-7304 (2015-03-13)
Invasive growth is a major determinant of the high lethality of malignant gliomas. Plexin-B2, an axon guidance receptor important for mediating neural progenitor cell migration during development, is upregulated in gliomas, but its function therein remains poorly understood. Combining bioinformatic
Daisuke Ito et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 934-943 (2015-06-28)
Mammalian target of rapamycin (mTOR) plays crucial roles in activation and differentiation of diverse types of immune cells. Although several lines of evidence have demonstrated the importance of mTOR-mediated signals in CD4(+) T cell responses, the involvement of mTOR in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.