Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU058001

Sigma-Aldrich

MISSION® esiRNA

targeting human CLU

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTAC

N° accesso Ensembl | uomo

ENSG00000120885

N° accesso NCBI

NM_001831

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CLU(1191) , CLU(1191)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
BBV
YYU
WNS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chiara Tarquini et al.
Aging, 12(11), 10129-10146 (2020-06-10)
Osteoarthritis (OA) is the most common joint disease characterized by destruction of articular cartilage. OA-induced cartilage degeneration causes inflammation, oxidative stress and the hypertrophic shift of quiescent chondrocytes. Clusterin (CLU) is a ubiquitous glycoprotein implicated in many cellular processes and
Lihua Mu et al.
Bioengineered, 11(1), 472-483 (2020-04-07)
Recent focus has turned to secretory clusterin (sCLU) as a key contributor to chemoresistance of anticancer agents, but the role of sCLU on chemotherapy drug response to gastric cancer cells is not fully understood. Previous research found that sCLU was
Na Fu et al.
Life sciences, 256, 117911-117911 (2020-06-07)
To explore the potential regulatory mechanism of differentially expressed mRNAs in Hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC). Patients with HCV-related HCC and age- and gender-matched healthy subjects were enrolled. Differentially expressed mRNAs in the plasma were detected by digital
Xiaohui Wang et al.
Current pharmaceutical biotechnology, 21(2), 131-139 (2019-08-23)
The aim of the study was to investigate the expression of sCLU in relation to the clinicopathological features and prognosis of patients with untreated High-Grade Osteosarcoma (HGOS) and to evaluate sCLU as a target for osteosarcoma (OS) therapies. The expression
Patricia M Schnepp et al.
Cancer research, 77(11), 2844-2856 (2017-04-13)
The impact of altered amino acid metabolism on cancer progression is not fully understood. We hypothesized that a metabolic transcriptome shift during metastatic evolution is crucial for brain metastasis. Here, we report a powerful impact in this setting caused by
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.