Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU055871

Sigma-Aldrich

MISSION® esiRNA

targeting human ETV5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TACCATCGGCAAATGTCAGAACCTATTGTCCCTGCAGCTCCCCCGCCCCCTCAGGGATTCAAACAAGAATACCATGACCCACTCTATGAACATGGGGTCCCGGGCATGCCAGGGCCCCCAGCACACGGGTTCCAGTCACCAATGGGAATCAAGCAGGAGCCTCGGGATTACTGCGTCGATTCAGAAGTGCCTAACTGCCAGTCATCCTACATGAGAGGGGGTTATTTCTCCAGCAGCCATGAAGGTTTTTCATATGAAAAAGATCCCCGATTATACTTTGACGACACTTGTGTTGTGCCTGAGAGACTGGAAGGCAAAGTCAAACAGGAGCCTACCATGTATCGAGAGGGGCCCCCTTACCAGAGGCGAGGTTCCCTTCAGCTGTGGCAGTTCCTGGTCACCCTTCTTGATGACCCAGCCAATGCCCACTTCATTGCCTGGACAGGT

N° accesso Ensembl | uomo

ENSG00000171656

N° accesso NCBI

NM_004454

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ETV5(2119) , ETV5(2119)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Duy Pham et al.
The Journal of allergy and clinical immunology, 134(1), 204-214 (2014-02-04)
The differentiation of TH17 cells, which promote pulmonary inflammation, requires the cooperation of a network of transcription factors. We sought to define the role of Etv5, an Ets-family transcription factor, in TH17 cell development and function. TH17 development was examined
Félicie Cottard et al.
Oncotarget, 8(42), 72008-72020 (2017-10-27)
Constitutively active androgen receptor (AR) variants have been involved in the expression of mesenchymal markers such as N-cadherin in prostate cancer (PCa). However, the underlying molecular mechanisms remain elusive. It remains unclear, whether N-cadherin gene (CDH2) is a direct transcriptional
Jong-Min Park et al.
Free radical biology & medicine, 110, 151-161 (2017-06-13)
8-hydroxydeoxyguanosine (8-OHdG) is generated consequent to oxidative stress, but its paradoxical anti-oxidative, anti-inflammatory, and anti-mutagenic effects via Rho-GTPase inhibition were noted in various models of inflammation and cancer. Metastasis occurs through cell detachment, epithelial-mesenchymal transition (EMT), and cell migration; during
Oorvashi Roy Puli et al.
Neoplasia (New York, N.Y.), 20(11), 1121-1134 (2018-09-29)
The ETS family of transcription factors is involved in several normal remodeling events and pathological processes including tumor progression. ETS transcription factors are divided into subfamilies based on the sequence and location of the ETS domain. ETV5 (Ets variant gene
Yong Cheng et al.
PLoS pathogens, 16(5), e1008569-e1008569 (2020-05-29)
Mycobacterial infection leads to activation of the RIG-I/MAVS/TBK1 RNA sensing pathway in macrophages but the consequences of this activation remains poorly defined. In this study, we determined that activation of this RNA sensing pathway stimulates ICAM-1 expression in M.avium-infected macrophage

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.