Passa al contenuto
Merck
Tutte le immagini(2)

Documenti

EHU051011

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(2)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCT

N° accesso Ensembl | uomo

ENSG00000166851

N° accesso NCBI

NM_005030

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PLK1(5347) , PLK1(5347)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jinhua Dong et al.
Biotechnology and bioengineering, 117(5), 1259-1269 (2020-02-11)
Ultra Quenchbody (UQ-body) is a biosensor that utilizes the quenching behavior of the fluorescent dye linked to the antibody V region. When the corresponding antigen is bound to the UQ-body, the fluorescence is restored and allows the detection of target
Hui Shi et al.
International journal of nanomedicine, 15, 3347-3362 (2020-06-05)
Temozolomide (TMZ) is the first-line chemotherapeutic option to treat glioma; however, its efficacy and clinical application are limited by its drug resistance properties. Polo-like kinase 1 (PLK1)-targeted therapy causes G2/M arrest and increases the sensitivity of glioma to TMZ. Therefore
Tomonori Higuchi et al.
Scientific reports, 7(1), 11026-11026 (2017-09-10)
The genetic events that lead to aggressive transformation of cases of splenic marginal zone lymphoma (SMZL) after the chronic clinical stage have not been well understood. We aimed to find candidate genes associated with aggressive features of SMZL. We have
Xiao Peng Cai et al.
American journal of translational research, 8(10), 4172-4183 (2016-11-11)
Cancer cell epithelial-mesenchymal transition (EMT) is the crucial event for cancer progression and plays a vital role in the metastasis of cancer cells. Activation of Polo-like kinase 1 (PLK1) signaling has been implicated as the critical event in several tumor
Dongzhi Wang et al.
Anti-cancer agents in medicinal chemistry, 17(7), 948-954 (2016-09-28)
Recent investigations have implicated that Chitosan-nucleotide nanoparticles might be useful non-viral carriers in gene therapy. Polo-like kinase 1 (PLK1) has been reported to be an important oncogene that exerted considerable therapeutic merit in hepatocellular carcinoma (HCC). We explored whether Galactosylated
Visualizza tutti i documenti correlati

Articoli

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.