Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU047961

Sigma-Aldrich

MISSION® esiRNA

targeting human GRK2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATCCCTTCTCGAAGAGTGCCACTGAGCATGTCCAAGGCCACCTGGGGAAGAAGCAGGTGCCTCCGGATCTCTTCCAGCCATACATCGAAGAGATTTGTCAAAACCTCCGAGGGGACGTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTGGAGCTCAACATCCACCTGACCATGAATGACTTCAGCGTGCATCGCATCATTGGGCGCGGGGGCTTTGGCGAGGTCTATGGGTGCCGGAAGGCTGACACAGGCAAGATGTACGCCATGAAGTGCCTGGACAAAAAGCGCATCAAGATGAAGCAGGGGGAGACCCTGGCCCTGAACGAGCGCATCATGCTCTCGCTCGTCAGCACTGGGGACTGCCCATTCATTGTCT

N° accesso Ensembl | uomo

ENSG00000173020

N° accesso NCBI

NM_001619

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... GRK2(156) , ADRBK1(156)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xuezhi Yang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 110, 834-843 (2018-12-18)
CP-25 attenuates arthritis progression in animal models by inhibiting G protein-coupled receptor kinase 2 (GRK2) membrane expression. This study compared groups treated with high-dose methotrexate (MTX)/leflunomide (LEF) and CP-25 combined with low-dose MTX/LEF in an adjuvant-induced arthritis (AA) rat model
Xuezhi Yang et al.
Cells, 8(12) (2019-12-11)
Rheumatoid arthritis (RA) is characterized by the massive infiltration of various chronic inflammatory cells in synovia. In synovial fluid of patients with RA, M1 macrophages are dominant among all subtypes of macrophages, the mechanisms of macrophages polarization imbalance in RA
Jing Cheng et al.
The Journal of clinical investigation, 130(2), 1036-1051 (2020-01-22)
Antigen receptor-dependent (AgR-dependent) stimulation of the NF-κB transcription factor in lymphocytes is a required event during adaptive immune response, but dysregulated activation of this signaling pathway can lead to lymphoma. AgR stimulation promotes assembly of the CARMA1-BCL10-MALT1 complex, wherein MALT1
Jie Xu et al.
Nature communications, 8, 14002-14002 (2017-01-17)
β-TrCP and SKP2 are two well-studied F-box proteins, which often act as oncogenes. Whether and how they communicate with each other is unknown. Here we report that FBXW2, a poorly characterized F-box, is a substrate of β-TrCP1 and an E3

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.