Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU044311

Sigma-Aldrich

MISSION® esiRNA

targeting human OLR1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGGACCAGCCTGATGAGAAGTCAAATGGAAAAAAAGCTAAAGGTCTTCAGTTTCTTTACTCTCCATGGTGGTGCCTGGCTGCTGCGACTCTAGGGGTCCTTTGCCTGGGATTAGTAGTGACCATTATGGTGCTGGGCATGCAATTATCCCAGGTGTCTGACCTCCTAACACAAGAGCAAGCAAACCTAACTCACCAGAAAAAGAAACTGGAGGGACAGATCTCAGCCCGGCAACAAGCAGAAGAAGCTTCACAGGAGTCAGAAAACGAACTCAAGGAAATGATAGAAACCCTTGCTCGGAAGCTGAATGAGAAATCCAAAGAGCAAATGGAACTTCACCACCAGAATCTGAATCTCCAAGAAACACTGAAGAGAGTAGCAAATTGTTCAGCTCCTTGTCCGCAAGACTGGATCTGGCATGGAGAAAACTGTTACCTATTTTCCTCGGGCTCATTTAACTG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Monica Villa et al.
Biochemical and biophysical research communications, 524(3), 696-701 (2020-02-09)
Inflammatory signals associated with cardiac diseases trigger trans-differentiation of cardiac fibroblasts to cardiac myofibroblasts. Cardiac myofibroblasts are the main cell type involved in the development of cardiac fibrosis, a diffuse and disproportionate accumulation of collagen in the myocardium. Although the
Tao Liu et al.
The Canadian journal of cardiology, 31(10), 1272-1281 (2015-06-23)
Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) is a membrane protein associated with apoptosis. Endoplasmic reticulum (ER) stress-induced apoptosis has been determined in several cardiovascular diseases. Mitogen-activated protein kinase (MAPK) signalling is involved in apoptosis. The aim of this study was
Baonian Liu et al.
Biochemical and biophysical research communications, 508(4), 1113-1119 (2018-12-17)
Immune responses against antigens generally require an efficient activation of antigen-presenting cells (APCs). Currently, the targeting of vaccine antigens to APCs has emerged as a promising strategy for boosting vaccine immunogenicity. Here, we reported that the C-terminus of heat shock
Chao-Hung Chen et al.
Journal of diabetes investigation, 11(3), 535-544 (2019-10-10)
Electronegative low-density lipoprotein (L5) is the most atherogenic fraction of low-density lipoprotein and is elevated in people with metabolic syndrome (MetS), whereas the retinol-binding protein 4 receptor (stimulated by retinoic acid 6 [STRA6]) cascade is disrupted in various organs of patients with
Zufeng Ding et al.
International journal of cardiology, 184, 86-95 (2015-02-24)
Shear stress, autophagy and LOX-1 are important players in atherogenesis. Direct impact of shear stress on autophagy development in endothelial cells and role of LOX-1 therein are undelineated. A parallel-plate flow chamber was used to vary shear stress (3 to

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.